Method for hla class ii typing

专利摘要:
A method of gene typing using a taxonomy based sequence analysis is described. The method can be used to type HLA-DQA1 and HLA-DQB1 alleles. The method uses fewer primers for PCR and sequencing and yields accurate DQA1 and DQB1 typing for both homozygous and heterozygous DNA.
公开号:CA2299675A1
申请号:C2299675
申请日:2000-03-10
公开日:2000-09-12
发明作者:Robert C. Brunham；Kalen Brunham；Yu Pan；Ma Luo
申请人:The University Of Manitoba；Robert C. Brunham；Kalen Brunham；Yu Pan；Ma Luo；
IPC主号:C12Q1-68

专利说明:
B&P File No. 9157-13 Title: Gene Typing Using A Taxonomy-based Sequence Analysis (TBSA) FIELD OF THE INVENTION The invention relates to a method of gene typing using a taxonomy based sequence analysis. In a preferred embodiment, it relates to HLA typing using a taxonomy-based sequence analysis. BACKGROUND OF THE INVENTION As the most polymorphic genetic system known in humans, HLA (human leukocyte antigen) plays a major role in regulating immune responses through binding and presenting peptides derived from both self and foreign proteins to T lymphocytes. HLA genes are important in tissue transplantation and are associated with a variety of infectious, autoimmune, and inflammatory diseases (1-3). HLA-DQ genes in particular are associated with several human diseases including type Idiabetes (4-10), IgA deficiency (11-13), multiple sclerosis (14-19), cancer susceptibility (20-26), clinical and immunological manifestations of HIVinfection {27, 28), celiac disease {29-34), idiopathic nephrotic syndrome (35), allergy (36-38), immune responses to parasite antigens (39) and pemphigus vulgaris (40, 41). In contrast to HLA-DR and -DP genes in which only the /3 chain is polymorphic, both a and (3 chains of HLA-DQ molecules are highly polymorphic. Thus, both germline and cis/trans combinational mechanisms generate DQ diversity. To correctly assess the association of DQ alleles with disease, requires accurate typing of both DQA1 and DQB1 alleles from each chromosome. Sequence-based HLA typing based on the polymerase chain reaction (PCR) can identify all nucleotide sequences in the amplified region of DNA and has the potential to detect new polymorphisms and has thus become a method of choice in HLA disease association studies. Although a sequence-based HLA class II typing method has been developed for DQA1 and DQB1 (42), the method requires use of RNA as the original typing material (42). As such it requires very high quality patient samples and sterile conditions that are difficult to meet in routine HLA laboratories and in many clinical studies. Very few sequence-based typing methods using genomic DNA as the original material have been reported for DQB1 (43) and none has been reported for DQA1. HLA-DRB genes are also associated with several human diseases including type I diabetes (7, 8, 55-61), multiple sclerosis (16, 18, 19, 62), pemphigus vulgaris (40, 41, 63-67), IgA deficiency (11, 13), cancer susceptibility (20, 21, 68), clinical and immunological manifestations of HIV infection (27, 69), inflammatory bowel disease (70-72), celiac disease (33), idiopathic nephrotic syndrome (35), rheumatoid arthritis (73-75), immune responses to antigens (76, 77), allergy (78-81) and many other inflammatory diseases including abdominal aortic aneurysm (82-90). In contrast to HLA-A, -B, -C and HLA-DQ, DP loci in which there is only one functional gene at each locus, there are up to four expressed genes (DRB1, B3, B4 and B5) and five sequence-related pseudogenes in HLA-DRB region. All individuals express a DRBl-encoded protein and usually one other functional DRB gene from DRB3, DRB4 and DRB5 loci. The DRBpseudogene sequences may serve as a donor site for recombination and/or gene conversion with functional DRB genes to rapid diversify of DRBalleles. Different DRB genes are organized into different preferred DRhaplotypes (91). Several sequence-based DRB typing method have been developed to resolve the complexity of the DRB genes (42, 43, 92-96). In general, the strategy of DRB typing methods is, first, to divide DRB genes into manageable units by using allele group specific primers to generate templates and then sequencing the amplified templates with preferred sequencing technology. These sequence-based DRB typing strategies, although reducing sequence ambiguities, do have some drawbacks. First, the exon sequences covered by and' outside the group specific PCR primers can not be analyzed. Recently, a DRB SBT typing method based on the conserved diversity of the non-coding regions has been developed to overcome this drawback (97, 98). Second, all these methods require samples to be pre-typed at low-resolution by serology or PCR-SSP and that this step requires either specific antisera or numerous PCR amplifications. In the situation where specific antisera are not available or where the amount of DNA is not sufficient, as in many clinical and disease association studies, these methods either will not be applicable and/or consume too much time and materials. In view of the foregoing, there is a need to develop novel methods for the typing of polymorphic genes such as the MHC or HLAgenes. SUMMARY OF THE INVENTION The present inventors have developed a DNA sequence-based typing systems that uses a taxonomy-based sequence analysis (TBSA) method to assign alleles for HLA-DQA1, DQB1 and DRB. The inventors have also developed a two step high resolution sequence-based DRBtyping method. The taxonomy based sequence analysis methods developed by the present inventors can be applied to typing other polymorphic genes. Broadly stated, the invention is for a method of typing a polymorphic gene in an organism using a taxonomy based sequence analysis (TBSA) method. In a TBSA method, a typing tree is prepared by obtaining a database of DNA sequences of known alleles of a gene of interest. This can be done using an already compiled database or by preparing a novel database. The database is then searched to identify polymorphic sites of the gene. Preferably, the polymorphic site is a polymorphic codon site. All or a subset of polymorphic codon sites could potentially be capable of assisting in typing of the alleles of a gene. The polymorphic codon sites used for allele typing are referred to as informative codon sites. The method of the invention entails determining which polymorphic codon sites can be used as informative codon sites to type the alleles of the gene. A typing tree is then developed for the gene based on the DNA sequences at the informative codon sites. In order to type a gene, DNA comprising the gene to be typed is obtained and sequenced. This can be done by a variety of methods, most preferably by obtaining a source of DNA from an organism whose gene is to be typed, amplifying the DNA using suitable primers and PCR and sequencing the DNA at the informative codon sites. If the sequencing of the DNA reveals no heterozygous codon sites, i.e., the organism is homozygous for the gene, then one can directly proceed with using the typing tree to assign the gene to be typed to a particular allele type. The typing process involves comparing the DNAsequence at the informative codon sites of the gene to be typed with the DNA sequences at these sites of previously typed alleles of the gene. In a preferred embodiment the remaining DNA sequence, or a suitable region thereof, for the gene to be typed is obtained. The DNAsequence of the allele that was typed is then compared with the sequence of the allele type in the database to confirm that codons belonging to the assigned allele type do exist in preferably all, the other locations and to check for any additional polymorphisms which would be associated with a previously unknown allele. Any previously unknown allele is assigned a new allele type and added to the database. The new allele has to be confirmed and reported to the WHO nomenclature committee to obtain a formal allele name designation. In the situation where the organism is heterozygous for the gene, the DNA sequence of the gene to be typed is used to identify heterozygous codon sites. The DNA sequence of the codons at a heterozygous site are determined by:1) only considering previously known codon sequence combinations at the heterozygous site; and 2) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences of the codons at that site.
The typing tree prepared for the gene is then used to assign codons at the heterozygous sites to a first allele and to subsequently type the first allele. Once the first allele has been typed, its sequence at heterozygous sites not used in typing should be checked to ensure codons belonging to the first allele type exist at all other locations and to assist in assigning codons at heterozygous sites to a second allele to be typed. Codons at heterozygous sites assigned to the first allele are not assigned to the second allele. The typing tree is then used to type the second allele, wherein codons at heterozygous sites assigned to the first allele are not considered in typing the second allele. In a preferred embodiment the DNA sequences of one, and preferably both alleles of the gene that was typed are obtained to ensure that all codons belonging to the assigned allele type exist at all other locations, and to confirm the typing assignment. It is also useful in identifying any new codon combinations warranting the assignment of a new allele type. In a preferred embodiment of the invention, the polymorphic gene is a HLA gene such as HLA-DQB1, HLA-DQA1 or HLA-DRB and the organism is a human. For HLA-DQB1 preferably the alleles characterised by polymorphisms in exons 2 and 3, and most preferably 2, are typed. For HLA-DQA1, preferably the alleles characterised by polymorphisms in exons 1, 2, 3, and 4, and most preferably exon 2, are typed. For HLA-DRB, preferably the alleles characterized by polymorphisms in exon 2 are typed. The invention also includes a computer based method of typing polymorphic genes in an organism. In one embodiment, the computer based method is used to prepare a typing tree and comprises the steps of:(A) inputting all known DNA sequences of known alleles of the gene into a database;
(B) searching the database for all polymorphic sites of the gene and identifying informative sites which can be used to type the known alleles of the gene; and (C) developing a typing tree based on the known DNA sequences at the informative sites of the known alleles of the gene. In another embodiment, a computer based method is used to type a gene and comprises:(1) inputting the DNA sequence at informative sites of the gene to be typed, recording more than one DNA sequence at a particular location if required;(2) searching the inputted DNA sequence in (1) for heterozygous sites;(3) if no heterozygous sites are located in step (2) then the allele of the gene is typed using the typing tree developed above;(4) if heterozygous sites are located:(i) determining the sequence at a heterozygous codon site by;a) only considering previously known sequence combinations at the heterozygous site; and b) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences at that site;(ii) having the computer program use the typing tree prepared above to assign the sequence of the heterozygous site to a first allele and to subsequently type the first allele;(iii) once the first allele has been typed checking, its sequence at heterozygous sites not used in typing to ensure sequences belonging to the first allele type exist at the other heterozygous sites and to assign sequences to the first allele at these sites; and (iv) assigning sequences at heterologous sites to a second allele to be typed wherein sequences at heterozygous positions assigned to the first allele are not considered in typing the second allele and using the typing tree prepared above to type the second allele; and (5) optionally inputting the full or partial sequences of both alleles, or one allele in the case of an the organism that is homozygous for the gene, and checking to ensure that all sequences belonging to the assigned allele type exist at other sequence sites, to confirm typing assignment and to identify any new sequence combinations warranting the assignment of a new allele type. In yet another embodiment the invention relates to a computer readable medium having stored thereon computer-executable instructions for performing all or some of the steps (A)-(C) and (1)-(5) outlined above. Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described in relation to the drawings in which: Figure 1 is an example of a HLA-DQB1 typing tree used in one embodiment of the invention. Figure 2 is an example of a HLA-DQAl typing tree used in one embodiment of the invention. Figure 3 is an example of a DRB typing tree used in one embodiment of the invention. Figure 4 is an example of a DRB typing tree used in one embodiment of the invention. _8_ Figure 5 is an example of a DRB typing tree used in one embodiment of the invention. Figure 6 is an example of a DRB typing tree used in one embodiment of the invention. Figure 7 is an example of a DRB typing tree used in one embodiment of the invention. Figure 8 is an example of a DRB typing tree used in one embodiment of the invention. Figure 9 is an example of a DRB typing tree used in one embodiment of the invention.Figure 10 is an example of a DRB typing tree used in one embodiment of the invention. Figure 11 is an example of a DRB typing tree used in one embodiment of the invention. Figure 12 is an example of a DRB typing tree used in one embodiment of the invention. Figure 13 is an example of a DRB typing tree used in one embodiment of the invention. Figure 14 is an example of a DRB typing tree used in one embodiment of the invention. Figure 15 is an example of a DRB typing tree used in one embodiment of the invention. Figure 16 is an example of a DRB typing tree used in one embodiment of the invention. Figure 17 is an example of a DRB typing tree used in one embodiment of the invention. Figure 18 is an example of a DRB typing tree used in one embodiment of the invention. Figure 19 is an example of a DRB typing tree used in one embodiment of the invention. Figure 20 is an example of a DRB typing tree used in one embodiment of the invention. Figure 21 is a flowchart of HLA typing method of the invention. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to novel methods of typing polymorphic genes in an organism. In a preferred embodiment, the novel typing method of the invention is used to type HLA genes, such as HLA-DQAl, HLA-DQB1 and HLA-DRB genes of an organism. An "organism" as used herein is any living body, including, but not limited to, plants and animals."Codon" as used herein is a sequence of three nucleotides forming the genetic code. Codons can direct placement of a particular amino acid in a polypeptide chain during protein synthesis. They can also act as a signal during protein synthesis, such as when used as start or stop codons. As used herein, the term "gene" is a segment of DNAoccupying a specific place on a particular chromosome and encoding a particular protein. As used herein, the term "allele" means one member of a pair or series of genes occupying a specific position (locus) in a specific chromosome. There can be several allele types or variations of a gene available within a population of organisms to occupy a particular locus in a chromosome. In humans, an individual has only two alleles for any gene. One gene derived from its male parent and the other from its female parent."Heterozygote" as used herein means an organism whose chromosomes contain two alleles for a gene, and wherein the alleles are different. "Heterozygous" pertains to an organism which is a heterozygote. "Heterozygous loci, position, or site" refers to codon sites where the two alleles in a diploid organism differ."Homozygous" pertains to an organism, which contains a pair of alleles for a gene, wherein the genes are identical. "Polymorphism" as used herein refers to genetic differences in an organism. "Polymorphic gene" is a gene which can have more than one allele type of a gene. "Polymorphic site" are sites on the gene where different DNA sequences have been found, i.e., the non constant regions of the gene. "Polymorphic codon" as used herein means a codon which can differ among alleles of the gene."Informative site" as used herein means a polymorphic sequence which can be used to distinguish one allele group or type from another."Informative codon" as used herein means a polymorphic codon which can be used to distinguish one allele group or type from another. It is not necessarily unique to one allele type. The invention in a preferred embodiment is for a method of typing a polymorphic gene in an organism comprising preparing a database of DNA sequences of known alleles of the gene. A person skilled in the art would appreciate that either an existing database or databases could be used or one could be prepared by compiling all the known sequences of the gene. A person skilled in the art would also appreciate that although one would endeavour to ensure that the database contains all the known sequences of the gene, the invention could work, although less well, if fewer than all the known sequences were included in the database. After the database of the DNA sequences has been obtained, it is used to identify the polymorphic sites, preferably codons of the gene. Alist of all known DNA sequences at these codon sites is compiled and informative codons which can be used to type alleles of a gene are identified. A typing tree of the gene is developed based on the DNAsequences at the informative codon sites of the known alleles of the gene. Accordingly, in one aspect the present invention provides a method of preparing a typing tree for typing a polymorphic gene in an organism comprising:(a) identifying polymorphic sites of the gene; (b) determining which polymorphic sites can be used as informative sites to type known alleles of the gene; and (c) developing a typing tree of the gene based on the DNAsequences at the informative sites of the known alleles of the gene. A typing tree is similar to a decision tree, where the allele type of a gene can be determined by following a path of DNA sequences at a series of pre-determined informative sites, preferably informative codon sites. If an allele has a particular DNA sequence at a particular informative codon site, then it is known that it will be of a certain allele type or types. Other types are eliminated. One then goes to the next informative codon in the typing tree and compares the codon of the gene to be typed with those of previously known and typed alleles, further narrowing the range of possible allele types. This process continues until one allele type for the gene is identified. In another aspect the present invention provides a method of typing a polymorphic gene in an organism comprising:(a) isolating DNA comprising the gene to be typed from the organism;(b) determining the DNA sequence at the informative sites of the gene to be typed; and (c) using a typing tree prepared according to the above method to assign the gene to be typed to a particular allele type by comparing the DNA sequence at the informative sites of the gene to be typed with the DNA sequences at the informative sites of previously typed alleles of the gene. To type the gene of a particular organism, DNA is obtained comprising the gene to be typed. The DNA can be obtained from a variety of sources. The source may be governed by the nature of the gene. For instance, the preferred source of DNA for typing HLA-DQA1 or DQBl is human blood. The DNA is then isolated and preferably amplified using suitable amplification primers. The amplified DNA is then preferably sequenced using PCR and suitable sequencing primers for obtaining the DNA sequences at the locations necessary for typing (i.e., informative codon sites). Any heterozygous codon sites are identified from the DNAsequences obtained from the organism to be typed. If no heterozygous codon sites are identified" i.e, the organism is homozygous for the gene, then the gene is ready to be assigned an allele type using the typing tree prepared for the gene, as described above. The DNA sequence at the informative codon sites of the gene to be typed are compared with the known DNA sequence at these sites for the previously identified and typed alleles of the gene. In order to confirm the allele typing, the DNA sequence of the gene at locations other than those used to type the gene are compared with the previously known DNA sequence for the allele type. This checks to ensure codons belonging to the assigned allele type exist in the other locations. Depending on the resolution desired in typing or the type of gene, all or part of the gene sequence is used to confirm the allele assignment. In one embodiment only informative codon sites not used in typing the particular gene or other polymorphic codon sites are checked.Again depending on the accuracy desired, a person skilled in the art would appreciate that confirmation of the gene typing can be an optional step of the method of the invention. The confirmation step outlined above can also be used to check for any additional polymorphisms which would be associated with a previously unknown allele. A new allele type is assigned to any previously unknown allele and added to the database of known alleles. The typing tree is then revised accordingly. It would be appreciated that DNA sequencing steps of the method of this invention can be done at one time to obtain all the necessary information or can be done at separate times using different or the same sequencing primers as required. If heterozygous codon sites are identified, then the DNAsequence of the codons at the heterozygous sites must be determined. This is preferably done by adhering to the following rules:1) only considering previously known codon sequence combinations at the heterozygous site; and 2) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences of the codons at that site. Once the DNA sequences of the codons at the heterozygous sites are determined, the typing tree is used to assist in assigning codons at the heterozygous site to a first allele and to subsequently type the first allele. Once the first allele has been typed, its sequence at heterozygous sites not used in typing should be checked to ensure codons belonging to the first allele type exist in all other locations and to assist in assigning codons at the heterozygous sites to a second allele to be typed. Any codons at heterozygous sites which are assigned to the first allele are not assigned to the second allele. Thus the sequence of the codons of the second allele are easily ascertained after the first allele is typed. Once this is done the typing tree is then used to type the second allele. Again, once one or both of the alleles have been typed, it is preferable to confirm the gene typing, to ensure that all codons belonging to the assigned allele type exists in all other locations and to identify any new codon combinations warranting the assignment of a new allele type. Preferably, the methods of the present invention are used to type HLA genes, more preferably HLA-DQB1, HLA-DQAl or HLA-DRBgenes. As will be explained in detail in the Examples, the inventors have prepared typing trees for these genes which are illustrated in FIgures 1-20. The inventors have also prepared novel primers which can be used to amplify these gene products which are identified in the Tables, The novel primers also form a part of the present invention. In one embodiment, the present invention provides a method of typing an HLA-DQB1 gene in a human comprising: (a) isolating DNA comprising the HLA-DQB1 gene to be typed;(b) determining the DNA sequence at informative codon sites of the HLA-DQB1 gene to be typed; and (c) using a typing tree as illustrated in Figure 1 to assign the HLA-DQBl gene to be typed to a particular allele type by comparing the DNA sequence at the informative codon sites with the DNA sequences at the informative codon sites of previously typed alleles of the HLA-DQB1 gene. In another embodiment, the present invention provides a method of typing an HLA- DQA1 gene in a human comprising:(a) isolating DNA comprising the HLA-DQA1 gene to be typed;(b) determining the DNA sequence at informative codon sites of the HLA-DQA1 gene to be typed; and (c) using a typing tree as illustrated in Figure 2 to assign the HLA-DQAl gene to be typed to a particular allele type by comparing the DNA sequence at the informative codon sites with the DNA sequences at the informative codon sites of previously typed alleles of the HLA-DQA1 gene. The present inventors have also developed a two-step high resolution sequence-based typing method for the typing of complex genes such as HLA-DRB. The system needs only one PCR reaction to type all functional DRB alleles of a given individual. The method uses a pair of generic PCR primers to amplify exon 2 DNA of all functional DRB genes and a first-step taxonomy-based sequence analysis (FSTBSA) method to assign allele groups after sequencing the PCR products with a generic primer. In the second step, group specific primers are used to sequence the same PCR products and a Taxonomy-based sequence analysis (TBSA) is used to assign alleles. Thus, both low resolution and high resolution DRBtyping can be done with PCR amplified exon 2 DNA from a single PCRreaction. As described in Example 2, the success of allele group assignment by FSTBSA was confirmed by subsequently sequencing the PCR products with group-specific primers and correctly assigning all 158 DNA samples in the study including 34 samples which had been typed by SSP or SSOPmethods. One hundred and sixteen heterozygous combinations of 81 DRB1-DRB3/4/5 haplotypes were successfully resolved by FSTBSAanalysis. Sixty-seven DRB1, 6 DRB3, 3 DRB5 and 1 DRB4 alleles were identified among the 158 individuals evaluated in this study. TBSAsuccessfully resolved all heterozygous allele combinations including 31 heterozygous combinations of 33 alleles of DRB1*03, 08, 11, 12 13 and 14 allele groups and 6 heterozygous combinations of 6 DRB3 alleles. Accordingly, the present invention also provides a method of typing a polymorphic gene in an organism comprising:(a) isolating DNA comprising the polymorphic gene to be typed from the organism;(b) amplifying the isolated DNA in a polymerase chain reaction using primers that selectively amplify the polymorphic gene to obtain PCR reaction products;(c) sequencing the PCR reaction products of step (b);(d) assigning an allele group to the gene based on the sequence information obtained in step (c);(e) amplifying the PCR reaction products of step (b) using primers that selectively amplify the allele group determined in step (d);(f) sequencing the PCR reaction products of step (e) to obtain the sequence at informative codon sites of the gene; and (g) assigning an allele to the gene using a typing tree prepared according to the method of the invention by comparing the DNAsequence at the informative sites of the gene with the DNA sequences at the informative sites of previously typed alleles of the gene. As described in Example 3, using the method of the present invention the inventors have determined that DRB1*0801 and DRB*1301 are more common amongst abdominal aortic aneurysm patients than controls. This demonstrates how the method of the present invention can be useful in diagnosing diseases. Accordingly, the present invention also includes a method of detecting abdominal aortic aneurysm comprising detecting the presence of the HLA-DRB alleles DRB1*0801 and DRB1*1301 in a sample from an animal. The application of the typing methods of the present invention can be facilitated by using computer programs which form part of the invention. In one embodiment, the computer program comprises a method of preparing a typing tree to type polymorphic genes in an organism comprising:(A) inputting all known DNA sequences of known alleles of the gene into a database;(B) searching the database for all polymorphic sites of the gene and identifying informative sites which can be used to type the known alleles of the gene; and (C) developing a typing tree based on the known DNA sequences at the informative sites of the known alleles of the gene. In another embodiment, a computer based method is used to type a gene and comprises:(1) inputting the DNA sequence at informative sites of the gene to be typed, recording more than one DNA sequence at a particular location if required;(2) searching the inputted DNA sequence in (1) for heterozygous sites;(3) if no heterozygous sites are located in step (2) then the allele of the gene is typed using the typing tree developed above;(4) if heterozygous sites are located:(i) determining the sequence at a heterozygous codon site by;a) only considering previously known sequence combinations at the heterozygous site; and b) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences at that site;(ii) having the computer program use the typing tree prepared above to assign the sequence of the heterozygous site to a first allele and to subsequently type the first allele;(iii) once the first allele has been typed checking, its sequence at heterozygous sites not used in typing to ensure sequences belonging to the first allele type exist at the other heterozygous sites and to assign codons to the first allele at these sites; and (iv) assigning sequences at heterologous sites to a second allele to be typed wherein sequences at heterozygous positions assigned to the first allele are not considered in typing the second allele and using the typing tree prepared above to type the second allele; and (5) optionally inputting the full or partial sequences of both alleles, or one allele in the case of an the organism that is homozygous for the gene, and checking to ensure that all sequences belonging to the assigned allele type exist at other sequence sites, to confirm typing assignment and to identify any new sequence combinations warranting the assignment of a new allele type. In yet another embodiment the invention relates to a computer readable medium having stored thereon computer-executable instructions for performing all or some of the steps (A)-(C) and (1)-(5) outlined above. The invention also includes a computer based method for typing an input gene sequence, comprising the steps of:a) providing a gene sequence database, said database containing a plurality of gene sequence records;b) removing any invalid codons from said input gene sequence; c) comparing condons in said input gene sequence to a set of working codons in each of said gene sequence records;d) if said input gene sequence matches one of said gene sequence records, recording a match; and e) outputting all matched sequence records. The invention further includesa computer readable medium having stored thereon computer-readable instructs for performing the steps comprising:a) providing a gene sequence database, said database containing a plurality of gene sequence records;b) removing any invalid codons from said input gene sequence;c) comparing condons in said input gene sequence to a set of working codons in each of said gene sequence records;d) if said input gene sequence matches one of said gene sequence records, recording a match; and e) outputting all matched sequence records. The present invention yet also includes a computer system for typing a gene sequence, said system comprising:a) a sequence database, said database containing a plurality of gene sequence records;b) input means for receiving input data, said input data to be compared with said gene sequence records;c) processing means for comparing said input data with said gene sequence records; and d) output means for outputting said gene sequence records that match said input data. The following non-limiting examples are illustrative of the present invention: EXAMPLES Materials and methods DNA samples DQA1 and DQB1 DNA sequence typing was performed with DNA extracted from leukocytes of 140 individuals. One hundred and thirty individuals were enrolled in an ongoing study of Chlamydia pneumorciae infection and vascular disease and 10 individuals were healthy laboratory personnel. The ten healthy laboratory personnel had previously been serologically HLA typed or typed using PCR-SSP (sequence specific primer) or PCR-SSOP (sequence specific oligonucleotide primer) methods. DNA Preparation DNA was extracted from 300 to 500 lzl of frozen whole blood using Puregene DNA Isolation Kits (Gentra Systems, Inc., Minneapolis, MN) or Split SecondTM DNA Preparation Kit (Roche Molecular Biochemicals). PCR amplification and sequencing primers The primers for amplifying exon 2 of DQB1 genes were adapted from those of Knipper et al. (2) and the primers for amplifying exon 2 of DQA1 gene were selected using the OSP primer selection program based on the genomic DNA sequence of human MHC class II DQA1 gene (HUMMHDQA02). Sequencing primers were selected using the OSP primer selection program and designed so that they were located at the least variable region. The amplification and sequencing primers are listed in Table 1. PCR reactions The 50 ul PCR reaction mixture consisted of 20 mM Tris-HCl (pH 8.4), 50 mM KCI, 1.5 mM MgCl2, 0.1% gelatin, 100 uM each dNTP, 25 pmol of each primer, 1.25 Unit of Tag DNA polymerase (GIBCO/BRL, Life Technologies) and 50 to 100 ng DNA. The cycle parameters used in the PTC-100 programmable Thermal Controller (MJ Research, Inc.) are 35 cycles of 1 min at 96°C, 1 min at 57°C (DQB) or 55°C(DQA), 1 min at 72°C, and followed by a 10 min incubation at 72°C. Five lzl of PCR reaction was checked by 1.5% agarose gel electrophoresis for the correctly sized PCRproducts. The remaining PCR products were purified with the 'High Pure PCR Product Purification Kit' (Roche Molecular Biochemicals) for sequencing. Sequencing reactions Ten ul (out of 70 lzl) of purified PCR products was used in each PCR sequencing reaction using DNA Cycle Sequencing System (GIBCO BRL Life Technologies). The optimal annealing temperatures for different sequencing primers are listed in Table 1. The sequencing mixture was heated at 95°C for five minutes before loading to a 0.2 to 0.4 mm thick 6% polyacrylamide-7M urea gel. The IBI Sequencer (EASTMAN KODAK Co.) was used for sequencing. The gel was electrophoresed at a constant power of 100 to 120 Watts for about 1.5 h and then vaccum dried (Model 583 gel drier, BIORAD) before being exposed to film. Sequence data processing and analysis Sequences were read and evaluated manually. Allele assignment was performed using a novel 'Taxonomy-based Sequence Analysis' (TBSA) approach of the invention as described in the result section. The databases of HLA-DQAl and -DQB1 were obtained from published sources (44) as well as from the world wide web site of the Anthony Nolan Research Institute (45). As of October 1998, the known HLA-DQAl database contains 19 alleles and the HLA-DQB1 database contains 35 alleles. Of the 19 DQA1 alleles, 12 are defined by polymorphisms in exon 2; 31 of the 35 DQB1 alleles are defined by nucleotide sequence variation in exon 2. The 7 remaining DQAl alleles are defined by polymorphisms in exons 1, 3 and 4, and the 4 remaining DQB1 alleles are defined by polymorphisms in exon 3. TOPO-TA cloning of the selected PCR products To evaluate the sequence-based DQ typing system, selected DNA samples were reamplified and cloned using the TOPO-TA cloning kit (Invitrogen Inc.). Six individuals with different DQB1 alleles and 10 individuals with different DQA1 alleles were selected for sequence analysis. The DNA samples were PCR amplified for DQA1 or DQB1 and cloned into PCR2.1-TOPO plasmids. Eight to twelve individual clones from each PCR amplification were sequenced. The DQ sequencing results obtained from cloned samples were compared with the results obtained using the TBSA approach of uncloned PCR products. Statistical analysis DQA1 and DQB1 allele frequencies were calculated by direct counting. Phenotypic frequencies were expressed as the percentage of individuals bearing the corresponding allele specificity. Heterozygosity was obtained by dividing the number of heterozygous individuals by the total number of alleles identified and the expected heterozygosity was calculated according to the formula, 1-~Pi2. ~Pi2 represents the sum of the squares of allele frequencies where Pi is the frequency of the ith allele. The formula [k-1] /k was used to calculate maximum heterozygosity, where k is the number of alleles at a given locus and when all alleles have the same frequency of 1 /k. DQA1-DQB1 haplotype frequencies (HP) were determined by direct counting. Linkage disequilibrium (LD), relative linkage disequilibrium (RLD), and c2 value were analyzed by the maximum likelihood method following the Hardy-Weinberg law (46). DQA1-DQB1 haplotypes were deduced based on: a) homozygosity at one locus or when one of the two haplotypes in a given person has been well defined, b) identification of previously described DQA1-DQB1 haplotypes in Canadian, American or other population (47); or c) the observed frequency of two given DQA1 and DQBl alleles. Results Control Samples and Confirmation by TOPO-TA Cloning TBSA of exon 2 DNA sequences was used to assign DQAl, DQBl and haplotype patterns to 10 control samples of known DQ type. In all cases, the new method exactly corroborated results of the known DQassignments previously obtained using standard methods (Table 2). Taxonomy-Based Sequence Analysis The ambiguous codon information obtained following sequencing of PCR amplified DNA from individuals who are heterozygous at the DQA1 and/or DQB1 locus made allele assessment a complex task. While analyzing the DQ sequences in the database, it was realized that the WHO Nomenclature Committee assigns alleles of DQA1 and DQB1 according to hierarchal codon sequence features, and that this type of analysis resembles a traditional taxonomic classification scheme. The present inventors surprisingly found that by applying a taxonomic classification method to the analysis of DQ sequencing data, the assignment of HLA allele designation could be simplified. For example, there are three nucleotide sequence combinations at codon 38 for the known DQB1 alleles in the database. Thus, according to the DNA sequence at codon 38, it is possible to divide the 35 DQB1 alleles into three groups with 6 alleles in the GCA group, 18 alleles in GCG group and 11 in GTGgroup (Fig.1). Each group can then be further subdivided according to the sequence character within the group at additional informative codons. For example, according to the DNA sequence at codon 37, the 11 alleles in the GTG group can be divided further into three groups and so on until an individual allele is determined (Fig. 1). To apply the method, it is necessary to initially prepare separate typing trees for DQAl and DQBl based on the sequence data from the current database. Figure 1 shows an HLA-DQBl typing tree and Figure 2 shows an HLA-DqA1 typing tree. The codons marked with a " * " are critical codons for identifying a particular allele or allele groups. When these codons appear in the sequence ladder, they should be given priority consideration in the allele assignment in the heterozygous situation. The shaded boxes are used for confirming a particular allele assignment in some heterozygous allele combinations where there are more than one possible codon selections at a particular locus.Separate typing tables for DQA1 and DQB1 that list all the informative codons with their known polymorphisms and space for recording new codons at the invariable region are also made. Typing tables are used to record sequence information relevant for allele assessment. Successful use of this typing scheme depends on the systematic application of three rules. First, when reading sequences at heterozygous loci one should only record codon sequences according to known codon sequence combinations that exist in the database; in other words, do not create new codons unless a nucleotide appears in a particular location for the first time. For example, in the DQBl database there are only three nucleotide combinations at codon 38 of DQB1, GTG, GCG and GCA. While theoretically, four combinations (GTG, GCG, GCAand GTA) are possible, GTA, has not been reported at this codon position and thus should not be inferred at this position. As well, the two assigned heterozygous codon combinations should use all the nucleotide information from sequencing at that position. Second, because each individual expresses a maximum of two different alleles at any given DQlocus, a mixture of two sequencing ladders is apparent in the heterozygous situation. Therefore, once one of the two alleles has been assigned, codons used in the heterozygous position for assigning the first allele should not be considered in the second allele assignment. Thirdly, once an allele type has been inferred using the typing tree, all codons throughout exon 2 should be checked to ensure that codons belonging to the assigned allele type do exist in all the other locations. This step is used to confirm the allele assignment and to check for the possible existence of a new allele due to new codons. Certain codon(s) exists only in a particular allele or allele group and is therefore critical in codon assignment; these codons are marked in the typing tree (Fig. 1 and 2). When assigning alleles using the typing tree, these codons should be given priority consideration in the heterozygous situation. In addition, assigning alleles in the DQB1*04 group should always be given priority in the heterozygous situation, especially when the other allele belongs to DQB1*02, 03 or 05 group.When an allele combination occurs between the DQB1*02 and DQB1*05 group, the alleles in the DQB1*05 group should be determined first in order to ensure correct typing. An example of assigning a DQB1 allele is shown in Table 3 for patient 52. In the DQB1 typing table of patient 52 there are two colon combinations at colon 38, GCA and GCG. According to the typing tree (Fig. 1) six DQB1 alleles have GCA at colon 38 and they all belong to a DQB1*03 group. Following the typing tree for the GCA group, the sequence of colon 57 can divide the six alleles into two groups. There are two colon combinations at colon 57 of patient 52, shown as GAT and GACin the typing table. According to the typing tree, there is no GAT at colon 57 in this group, but GAC is a recognized colon in the DQB1*03 group and thus narrows down the possible DQB1 alleles to three. The colon 45 sequence of GGG excludes DQB1*0301, and the colon 62 sequence of AACtherefore assigns the allele as DQB1*03032. Once the DQB1*03032 allele has been assigned, all the colons are checked to ensure they are sequences of the assigned allele, and the colons checked at the heterozygous position will not be used in the second allele assignment of this heterozygous sample. For assigning the alternate DQB1 allele, according to the typing tree, we again start with colon 38, and the second allele is quickly assigned as DQB1*0602. If all the colons at the heterozygous positions are consistent with the DQB1*0602 allele and there are no new colons at constant regions, the DQB1 typing for this patient is complete, and the sample is typed as DQB1*03032/0602. However, in this case there is a new colon combination at colon 60, an AAC in addition to TTC. Therefore, the DNA sample needed to be reamplified with another DNA polymerase and resequenced to confirm the new colon. If the sequence is confirmed on the uncloned DNA, the PCR products are cloned and sequenced to verify which one of the two alleles carries the new colon. In this case, we confirmed that the patient DQB1*0602 carries the new colon (50). Thus, TBSA can correctly assign alleles for heterozygous DNA samples. This analysis successfully resolved all twenty-one heterozygous combinations of eight DQA1 alleles or allele groups that were detected among 134 DNA samples (Table 4a). TBSA also successfully resolved 45 out of 49 heterozygous combinations among the 19 assigned DQB1 alleles (Table 4b). Since the heterozygotes combinations DQB1*0201/02/DQB1*03011 and DQB1*0203/DQB1*0304, as well as heterozygotes DQB1*03011/DQB1*0302 and DQB1*03032/DQB1*0304 have the same codon combinations at exon 2, allele specific PCR-SSP (48) needs to be used for final allele assignment when these allele combinations are identified. This is a common limitation faced by other sequence analysis methods as well. To corroborate the accuracy of TBSA allele assignments, DNAfrom six individuals with different DQB1 alleles and ten individuals with different DQA1 alleles were randomly selected for re-amplification and cloning. Eight to 12 individual clones were sequenced for each cloned PCRproduct and the results confirmed the TBSA allele assignments in all 16 cases (data not shown). Evaluation of primers for DQA1 typing There is a very high degree of sequence similarity between DQA1 gene sequences and DQA2 pseudogene sequences (49). To obtain correct typing of DQA1 genes, it is necessary to eliminate background caused by DQA2. We designed PCR primers specific for DQA1 to eliminate the interference from DQA2 (Table 1). Certain DQA1 alleles, such as DQAl*02s, 04s to 06s, have a deletion of codon 56, causing a frame shift in sequencing ladders and making the reading of the DNA sequence beyond codon 56 difficult. Therefore, by using two sequencing primers, sense primer DQASEQ3 and antisense primer DQASEQ2, we can obtain the codon information required for typing of all DQAl alleles except alleles belong to the DQAl*05 group. Subtyping alleles in the DQA1*05 group requires sequencing information of codons 8 and 21 obtained with the antisense primer DQASEQ4. HLA-DQA1 typing results Since seven of 19 DQA1 alleles differ only at exon l, 3, or 4, sequencing of exon 2 alone will not give full typing results for all DQA1 alleles. However, exon 2 polymorphisms are likely to be most relevant to peptide presentation specificity of DQ molecules and we have focused our attention on defining uambiguous sequences from this region. Based on the sequence information from exon 2, nine alleles or allele groups including a new allele (51) were detected among the 134 DNA samples at the DQA1 locus. DQA1*06s, DQA1*0502, and DQA1*0504 were not detected among these DNA samples. Of the 134 DNA samples typed for DQAl, 112 samples (84%) were heterozygous. The observed heterozygosity thus fits very well with the expected heterozygosity (84%) and is lower than the maximum expected heterozygosity (88%) for 8 alleles. The 22 (16%) homozygotes for DQA1 include DQA1*0101/04/05(n=4), DQA1*0201(n=2), DQA1*03011/02/03(n=6), DQA1*0401(n=2), and DQA1*05011/13/03(n=8). The frequency for each DQA1 allele, allele combination and phenotype is given in Table 6. The comparison of DQA1 allele frequencies detected in this study (Table 7) was virtually identical to that reported for other studies using Canadian and American Caucasian populations (47). Evaluation of primers for DQB1 typing Preliminary experiments demonstrated that PCR primers flanking exon 2 of DQB genes (43) are DQB1 specific when the PCR reaction is carried out at the optimal annealing temperature (57°C) and when the proper concentration of dNTPs (100 1ZM) is chosen. As shown in table 5 both the 5' and 3' primers for DQB1 have two nucleotide mismatches with DQB2 (49), thus significantly lowering the Tm for DQB2 sequences. In practice, under the specified PCR conditions we failed to detect DQB2 sequences among all 135 samples typed for DQB1. DQB2 pseudogene sequences, if present,.would be apparent because of a distinctive deletion of codon 56 (49). Two sequencing primers, sense primer DQBSEQ1 and antisense primer DQBSEQ3, are sufficient to obtain exon 2 sequence information of DQB1 for typing. Sequence information obtained using sense primer DQBSEQl was sufficient to assign most alleles except for some in the DQB1*06 group that require antisense primer DQBSEQ3 to obtain information for codon 9 and 14. HLA-DQB1 typing results All but four DQB1 alleles can be defined based on sequence information from exon 2. The four DQB1 alleles that differ only at exon 3 include DQB1*0201/02 and DQB1*06011/13. Of the 135 DNA samples that were fully typed for DQB1, 112 (83%) were heterozyous with 19 alleles identified. The observed heterozygosity was lower than both the expected heterozygosity (87%) and the maximum expected heterozygosity (95%) for 19 alleles. Twenty three (17%) of the 135 DNA samples were homozygous for DQB1 and included DQB1*0201/02(n=9), DQB1*0301(n=6), DQB1*0501 (n=4), DQB1*03032(n=1), DQB1*0304(n=1), DQB1*0602(n=1), and DQB1*0604 (n=1). Among the 19 detected DQB1 alleles, we identified a new DQBl*06 allele (50). The frequency of each detected DQB1 allele and phenotype in this population sample is given in Table 6. Comparison of DQB1 allele frequencies found in this study (Table 7) was also similar to that of other reported Canadian and American Caucasian populations (47). DQA1-DQB1 haplotypes and linkage disequilibrium The deduced DQAl-DQB1 haplotypes, their frequencies (HP), linkage disequilibrium (LD), and relative linkage disequilibrium (RLD) and 02 value are compared with other Canadian and American Caucasian populations in Table 8 (47). In general the relative DQAl-DQB1 haplotype frequencies observed in this study are comparable to those observed in other studies involving subjects of North American Caucasian ancestry. Discussion Successful sequence-based DQAl and DQB1 typing depends on several factors. These include technical issues as well as analytical issues. Among the technical issues, the quality of DNA isolation is particularly important. The quantity of DNA used in the PCRamplification is important as too much DNA can result in over amplification of one allele in the heterozygous situation. The inventors' experience with 50 to 100 ng of DNA in a 50 ul PCR reaction suggests that this amount is sufficient to ensure balanced amplification of both alleles when using good quality DNA. The annealing temperature and amount of dNTPs used in the PCR reaction are critical to ensure the fidelity and even amplification of both alleles. It has been shown that, one pair of PCRprimers which amplify all DQB1 alleles (43) is sufficient for typing all DQB1 alleles. The primers do not amplify DQB2 if the proper annealing temperature and dNTP concentration are used in the PCR reaction. Since specific primers amplifying each allelic group of DQB1 are not needed, this simplifies the typing process. The sense sequencing primer DQBSEQ1 is sufficient for typing most DQB1 alleles except for DQB1*0602 and 0611 which require the antisense primer DQBSEQ3 in order to obtain information for codons 9 and 14. In DQA1 typing, the proper annealing temperature for sequencing needs to be followed, especially for DQASEQ3 and DQASEQ4, in order to ensure balanced typing of both alleles. Too high a temperature can result in allele drop out due to sequence differences between DQA1*Ols and the other groups. Two sequencing primers, DQASEQ2 and DQASEQ3 are needed in order to obtain sequence information to type most DQAl alleles except for the DQA1*05s group which requires the antisense primer DQASEQ4 for subtyping. Since several DQA1 alleles differ only at exons 1, 3 or 4, sequences of exon 2 alone will not subtype all the DQA1 alleles. However, sequence information in these exons may not be necessary for all studies, since sequence differences outside of exon 2 may not have immunological significance. Among the analytical issues that proved particularly problematic was the correct inferrence of DNA sequences at heterozygous codons. A simple solution to this problem was provided by the hierarchal codon TBSA analysis of the present invention. The utility of the TBSAapproach was initially demonstrated by correctly typing 10 control samples from healthy laboratory personnel that had been previously typed by PCR-SSOP or serology, and subsequently confirmed by sequencing of cloned PCR products. The TBSA method was able to successfully analyze sequence data obtained from most test subjects. All 21 DQA1 heterozygous combinations and 45 of 49 DQB1 heterozygous combinations were successfully resolved with TBSA. The two pairs of heterozygous DQB1 combinations not resolved with TBSA required sequence specific PCRamplification for correct identification. As well, by using primers for other exons, it also proved feasible to give full typing for all DQAl and DQB1 alleles which had polymorphisms outside of exon 2. The methods can be easily updated to accommodate new DQAl and DQB1 alleles and the analysis method can be used both for sequence-based typing using manual or automatic sequencers. We recently developed a computer software program based on TBSA which makes sequence-based DQA1 and DQBl typing an even easier task as described in Example 4. The principle of TBSA can likely be applied to typing of other genes with multiple alleles. In Example 1, we reported the development of a taxonomy-based sequence analysis (TBSA) method to assign DQ alleles in the heterozygous situation in order to study the association of HLA-DQ alleles with Chlamydia immunopathology (99). This example relates to a simplified two-step DRB sequence-based typing approach that uses a first-step taxonomy-based analysis to assign allele groups (FSTBSA) and a taxonomy-based sequence analysis (TBSA) method to assign alleles in the second step. The system uses fewer primers for PCR than other reported methods and yields accurate DRB typing at both low and high resolution for both homozygous and heterozygous DNA using peripheral blood samples. Materials and Methods DNA Samples DRB DNA sequence typing was performed with DNAextracted from leukocytes of 158 individuals. One hundred and twenty four individuals were enrolled in an ongoing study of Chlamydia pneumoniae infection and vascular disease (AAA Study); twenty four individuals were enrolled in an infertility study in Nairobi, Kenya (INF study) and 10 individuals were healthy laboratory personnel. The twenty four individuals enrolled in the infertility study and ten healthy laboratory personnel had previously been independently typed for DRBusing PCR-SSP or PCR-SSOP methods. DNA Preparation DNA was extracted from 300 to 500 ul of frozen whole blood using Puregene DNA Isolation Kits, GenerationTM Capture Column Kit (Gentra Systems, Inc., Minneapolis, MN, USA), QIAGEN DNA isolation kit (QIAGEN Inc., Mississauga, Ont. Canada), or Split SecondTM DNA Preparation Kit (Roche Molecular Biochemicals). The DNA was quantified by standard UV spectrophotometric analysis. In general 2 to 5 iZg DNA was obtained from 300 to 500 ul of whole blood. PCR Amplification and Sequencing Primers The primers for amplifying exon 2 of DRB1, 3, 4, 5 genes were designed to include all the known variable sequences identified in the exon 2 region. Sequencing primers were designed in two ways. One set of sequencing primers were designed to selectively sequence different allele groups, the other set of primers were designed at the conserved regions to sequence all known DRB alleles. The amplification and sequencing primers are listed in Table 9. PCR Reactions The 100 ~1 PCR reaction mixture consisted of 20 mM Tris-HCl (pH 8.4), 50 mM KCI, 1.5 mM MgCl2, 0.1% gelatin, 100 1ZM each dNTP, 25 pmol of each primer, 2.5 units of Tag DNA polymerase (GIBCO/BRL, Life Technologies) and 50 to 100 ng DNA. The cycle parameters used in the PTC-100 programmable Thermal Controller (MJ Research, Inc.) are 35 cycles of 1 min at 96°C, 1 min at 55°C, 1 min at 72°C, and followed by a 10 minute incubation at 72°C. Five lZl of PCR reaction was checked by 1.5%agarose gel electrophoresis for the correctly sized PCR products. The remaining PCR products were purified with the 'High Pure PCR Product Purification Kit' (Roche Molecular Biochemicals) for sequencing. Sequencing Reactions Ten ul (out of 70 lxl) of purified PCR products was used in each PCR sequencing reaction using DNA Cycle Sequencing System (GIBCO BRL Life Technologies). The optimal annealing temperatures for different sequencing primers are listed in Table 9. The sequencing mixture was heated at 95°C for five minutes before loading to a 0.2 to 0.4 mm thick 6% polyacrylamide-7M urea gel. The IBI Sequencer (EASTMAN KODAK Co.) was used for sequencing. The gel was electrophoresed at a constant power of 100 to 120 Watts for about 1.5 h and then vaccum dried (Model 583 gel drier, BIORAD) before being exposed to film. Sequence Data Processing and Analysis Sequences were read and evaluated manually. Allele group analysis and allele assignment were performed using a novel two step 'Taxonomy-based Sequence Analysis' (TBSA) approach as described in the result section. The database of HLA-DRB was obtained from published sources (53) as well as from the world wide web site of the Anthony Nolan Research Institute (45). As of October 1999, the known HLA-DRB database contains 223 DRB1 alleles, 19 DRB3 alleles, 8 DRB4 alleles and 13 DRB5 alleles. Of the 223 DRBl alleles, 222 are defined by polymorphisms in exon 2. Eighteen of the 19 DRB3 alleles, 5 of the 8 DRB4, and 11 of the 13 DRB5 are defined by nucleotide sequence variation in exon 2. The remaining 7 DRB alleles are defined by polymorphisms in exons 3. The DRB typing trees were created, partially, with the assistance of a computer program developed by Embedded Solutions Inc. (KBB, Winnipeg, Canada). Statistical Analysis DRB allele frequencies were calculated by direct counting. Phenotypic frequencies were expressed as the percentage of individuals bearing the corresponding allele specificity. Heterozygosity was obtained by dividing the number of heterozygous individuals by the total number of alleles identified and the expected heterozygosity was calculated according to the formula, 1-~Pi2. ~Pi2 represents the sum of the squares of allele frequencies where Pi is the frequency of the ith allele. The formula [k-1]/k was used to calculate maximum heterozygosity, where k is the number of alleles at a given locus and when all alleles have the same frequency of 1/k. DRB haplotype frequencies (HP) were determined by direct counting. Linkage disequilibrium (LD), relative linkage disequilibrium (RLD), and x2 values were analyzed by the maximum likelihood method following the Hardy-Weinberg law (46). DRBhaplotypes were deduced based on: a) homozygosity at one locus or when one of the two haplotypes in a given person has been well defined, b) identification of previously described DRB haplotypes in Canadian, American or other population (47); or c) the observed frequency of given DRB alleles. Results Two Step Taxonomy-Based Sequence Analysis In Example 1, we describe a Taxonomy-Based Sequence Analysis (TBSA) method for use in DQA and DQB allele assignment (99). The TBSA was able to resolve ambiguous codon information obtained following sequencing of PCR amplified DNA from individuals who are heterozygous at the DQAl and/or DQB1 locus. The greater complexity of DRB genes, both in number of alleles and haplotype structures, brings more challenge to allele assignment. First, there are nine DRB genes and among them only four are functional (DRB1, 3, 4 and 5). These DRB genes are organized into different haplotypes (91). Second, there are many alleles at each functional DRB locus with 223 alleles at DRB1 alone (45, 53). Third, each person can express from two to a maximum of four different DRBalleles, including two DRB1 alleles and two other DRB genes (DRB3, DRB4 and DRBS). So far sequence-based DRB typing strategies have been based on samples that are first typed at low resolution using serology, PCR-SSPor PCR-SSOP method followed by high resolution typings achieved by sequencing the PCR-SSP amplified DNA. In situations where no specific antisera exists and/or available DNA is low a simplified method is needed. Although great polymorphism exists in DRB genes, each group of DRB genes and their alleles have unique signature sequence, WHO Nomenclature Committee has classified DRB genes into different allele groups according to the characteristics of their sequences. We summarized these sequence features and list them in Table 10. Based on the sequence features of each DRB allele group, we can analyze the sequence information after the first round of sequencing to assign the allele groups of a given individual. Therefore, low resolution DRB typing can be done from a single PCR reaction with a pair of generic PCR primers, one sequencing reaction and a First-step Taxonomy-based Sequence Analysis (FSTBSA). The FSTBSA is based on the presence of critical and feature specific codons of different DRB genes and their allele groups (Table 10). The analysis also takes account of identified haplotype organization (91) and the maximum of functional DRB genes an individual can have. An example of low resolution DRB typing by FSTBSA is given in Table 11. The sequence of the sample 002 has "CAG"at codon 9, "GAT" at codon 11, "GAC" at codon 30 and "CAC" at codon 28. All these codons are critical codons of DRB5 except for codon 28 "CAC"that is also a character of DRB1*09012. Because there is no "TAT" at codon 26 that is a critical codon of DRBl*09012, the possibility of DRB1*09012 is excluded and DRB5 is the first assignment. Since, usually DRB5 is in linkage disequilibrium with DRBl*15 and 16 allele groups and the sample does have codons that only exist in these two DRB1 allele groups (codon 11 CCT, codon 13 AGG), the second assignment for the sample is DRB1*15 or 16. The third assignment for this DNA sample is DRB3*03 because of the occurrence of "CTG" at codon 11, "TTC" at codon 26, "GAG" at codon 28, "ACG" at codon 51 and "GGC" at codon 73. DRB1*03, 13, or 14 was the fourth assignment based on the occurrence of "ACG" at codon 12 and "TCT" at codon 13 as well as the knowledge that these DRB1 allele groups are, usually, in linkage disequilibrium with DRB3 genes. Once the low resolution typing has been done by FSTBSA, group specific sequencing primers (see Table 9) are to be used to sequence the identified allele groups for high resolution typing. In this case, the sample 002 was to be sequenced separately with DRB3, DRBS, DRB1 * 15 / 16 and DRB 1 *03 / 13 / 14 group specific primers for the final high resolution typing. A second-step Taxonomy-based Sequence Analysis was then used for the final allele assignment after sequencing with group specific primers. We have developed typing trees (Figures 3-20) based on the principle of Taxonomy-based Sequence Analysis (TBSA). Allele assignment can be done with ease following the steps of the typing trees.Due to the numerous alleles that exist at the DRB locus, different alleles groups can share identical colons in the variable region and we therefore introduced confirmation colons in the typing trees to help allele assignment in the heterozygous situation. These confirmation colons can help users to decide whether the selection of steps in the typing tree are correct. TBSA allele assignment of DRB genes follows the same principle described in Example 1. First, when reading sequences at heterozygous loci one should only record colon sequences according to known colon sequence combinations that exist in the database; in other words, do not create new colons unless a nucleotide appears in a particular location for the first time. As well, the assigned heterozygous colon combinations should use all the nucleotide information from sequencing at that position. We made a DRB Typing Colon Reference Table (Table 12) that contains all the identified colons at the variable region to assist colon selection. Second, because each individual expresses a maximum of two different alleles at any given DR locus, a mixture of two sequencing ladders is apparent in the heterozygous situation when sequenced with group specific primer. Therefore, once one of the two alleles has been assigned, colons used in the heterozygous position for assigning the first allele should not be considered in the second allele assignment. Thirdly, once an allele type has been inferred using the typing tree, all colons throughout exon 2 should be checked to ensure that colons belonging to the assigned allele type do exist in all the other locations. This step is used to confirm the allele assignment and to check for the possible existence of a new allele due to new codons. Certain condon(s) exists only in a particular allele or allele group and this step is therefore critical in codon assignment;these codons are marked in the typing tree (Figures 3-20). When assigning alleles using the typing trees, these codons should be given priority consideration in the heterozygous situation. While allele assignment can be easily done with TBSA in most heterozygous haplotype situations, it is more challenging to assign alleles in individuals who have two different DRB1*04 alleles or individuals with two different DRBl*03, 11, 12, 13 and 14 alleles due to the numerous alleles that exist in these groups and shared codons in the variable regions among the alleles. Thus we chose an example of assigning DRB1 alleles of an individual who is heterozygous with DRB1*03 and 13 (DR3 and DR13 haplotypes) to illustrate the typing process. Sample 6-1 was typed as DRB3*02 or DRB3*02 and 03, DRBl*03, and 13 or 14 after first round sequencing and FSTBSA analysis. The sample was then sequenced with DRB031234SEQ sequencing primer that has a specificity for DRB1*03, 12, 13 and 14 allele groups. The sequencing result was recorded in the typing table (Table 13). According to the codon information recorded in the typing table there was no trouble initially to follow the typing trees, from codon 19 AAT, codon 28 GAC, to codon 13 TCT until codon 73 where the two codons GGC and GCC split into different branches in the typing tree (Figure 7). Since codon 73 recorded in the typing table has a heterozygous codon combination of GGC/GCC, it is apparent that the two DRB1 alleles of the sample belong to different allele groups on the typing tree. There are eight heterozygous codons from codon 19 to codon 90 on the typing table, and the question is which codon(s) should be used to assign alleles in each group The confirmation codons provide the necessary information for decision making. According to the confirmation codon information on the GGC branch of codon 73 (Figure 7), codons 67 ATC, 69 GAA, 70 GAC, 71 GAG and 74 GCG should be in allele assignment on the GCC branch of codon 73. Therefore, following the GCC branch of the typing tree we can narrow down the allele assignment to three candidates, DRB1*1301/02/27. In a similar way the allele belongs to the GGC branch of codon 73 was narrowed down to three alleles, DRB1*03011/05/07. The final allele assignment depends on information of two heterozygous codons, 26 and 86. In this case, the ambiguous codon combination cannot be resolved by sequencing information obtained with the group specific sequencing primer DRB031234SEQ alone. However, it can be resolved by sequencing the same PCR product with 86 seq primer that is specific for alleles that have GTG at codon 86. Codon 26 TTC and codon 86 GTG were thus proven to belong to DRB1*13 and the sample was finally typed as DRB1*0305 and DRB1*1301 heterozygote at DRB1 locus. . DRB3 typing of the sample was done by sequencing the PCR product with DRB3 specific primer DRB3SEQ and by analysis of the sequence information with TBSA following the typing trees in an identical fashion. In summary, sequence-based DRB typing of PCR amplified exon 2 DNA can be done in two steps. In the first step, low resolution DRBtyping can be achieved by a single PCR amplification and one round of sequencing, followed by a FSTBSA analysis. In the second step, the samples are typed at high resolution by sequencing with group specific primers and TBSA analysis of the sequence information. FSTBSAsuccessfully assigned allele groups of all 158 samples in this study including 10 laboratory control samples and 24 infertility patient samples all 34 of whom had been previously typed by PCR-SSP or PCR-SSOP. Ninety heterozygous combinations of 66 DRB1-DRB3/4/5 haplotypes were detected in 124 DNA samples of patients (mostly Caucasians) enrolled in the AAA study. Twenty-three combinations of 19 DRB1-DRB3/4/5 haplotypes were detected in 24 patients (East African) samples enrolled in INF study. Ten combinations of 13 DRB1-DRB3/4/5 haplotypes were detected in the ten laboratory control samples. In sum, 116 heterozygous combinations of 81 DRBl-DRB3/4/5 haplotypes were successfully resolved by FSTBSA analysis. Successful FSTBSA allele group assignment was also confirmed by the group specific sequencing with group specific primers in the second step. In the second step, high resolution DRB1, DRB3, DRB4 and DRB5 typing were achieved by TBSA analysis of sequencing information after sequencing with group specific primers. TBSAsuccessfully resolved all heterozygous allele combinations including 31 heterozygous combinations of 33 alleles of DRB1*03, 08, 11, 12 13 and 14 allele groups (Table 18) and 6 heterozygous combinations of 6 DRB3 alleles detected in 158 DNA samples (Table 17). Control Samples To evaluate the two-step DRB typing method, we used two groups of control samples that had been previously typed by PCR-SSP or PCR-SSOP method. The first group is 24 Nairobi samples from INF study. These samples had been previously typed using PCR-SSOP method. The second group of 10 samples were healthy laboratory personnel. These samples had been previous typed by PCR-SSP or PCR-SSOP method and they were used as blind controls. FSTBSA correctly assigned the allele groups of all control samples after first round of sequencing the PCRproducts generated with a pair of generic DRB primers. Of 20 DRB1 alleles typed in 10 blind control samples, 18 (90%) are in concordance with PCR-SSP or PCR-SSOP results. The discrepancies of 2 alleles are not due to errors in sequencing results but due to errors that occurred during manual reading of the sequences. Thus, double checking the typing results by two individuals is necessary for quality control the typing results. Forty DRB3, DRB4, and DRB5 alleles were detected in the 24 patient samples in INFstudy, 35 (87.5%) are in concordance with PCR-SSOP results. PCR-SSOPfailed to detect DRB3*02021 in 2 samples and failed to detect DRB3*0301 in 3 samples. Of forty eight DRB1 alleles typed in the samples of INF study, 37 (77.1%) are in concordance with the results by PCR-SSOP. The discrepancies of 9 alleles include four DRB1*1503 alleles that were typed by PCR-SSOP as DRB1*1501 and five other allele combinations could not be distinguished by PCR-SSOP. Evaluation of Primers for DRB Typing Generic primers designed to amplify all DRB genes (93) were first used to amplify exon 2 DNA. The primers worked well in amplifying all DRB genes under the indicated PCR conditions. However, because the 3'-end primer annealing to codons 88-94, 23 DRBl alleles cannot be resolved due to the lack of sequence information from codons 88 and 90. We therefore designed a pair of generic PCR primer outside the variable regions of exon 2 of all identified DRB1, DRB3, DRB4 and DRB5 genes except 2 DRB5 alleles (DRB5*0202 and DRBS*0204). Since codon 7 is not critical in allele assignment for DRBS genes, thus the exclusion will not affect the typing results. The inclusion of codon 88 and 90 in the amplification makes it possible to type all identified functional DRBalleles. Identifying HLA-DRB intron sequences around exon 2 (97, 98) also makes it possible to analyze the generic PCR primers extending from introns to exon 2. The generic DRB PCR primers amplified all DRB genes when PCR reactions were carried out at the indicated annealing temperature (Table 9) and the PCR conditions listed in the methods were properly followed. Two sets of generic sequencing primers were designed for the first round of sequencing. Antisense sequencing primer DRBSEQ4 located at 3'-end of exon 2 was designed to sequence all the functional DRB genes. One round of sequencing with this sequencing primer will provide all the codon information for the low resolution tvnin~ with FSTRSA_ Alternatively, one can use the other set of generic sequencing primers, sense primer DRBSEQ1 and antisense primer DRBSEQRl. The two primers are located at the conserved region of all functional DRB genes. All three generic sequencing primers are specific for the functional DRBgenes if used at the proper annealing temperature (Table 9). Group specific sequencing primers for sequencing specific allele groups after first round of low resolution typing are listed in Table 9. These primers if used at the indicated annealing temperature are specific for the allele groups. The sequencing primer 86SEQ and 58SEQ were only needed to resolve ambiguities in certain heterozygous combinations. HLA-DRB Typing Results Of the 158 DNA samples that were fully typed for DRB1, 151 (95.6%) were heterozyous with 66 alleles identified. The observed heterozygosity was higher than the expected heterozygosity (94.4%), but lower than the maximum expected heterozygosity (98.5%) for 66 alleles. Seven (4.4%) of the 158 DNA samples were homozygous for DRB1 and they include DRB1*0101(n=2), DRB1*04011(n=2), DRB1*0701(n=2) and DRB1*15011(n=1). The frequency of each detected DRB1 allele and phenotype in 124 patient samples of AAA study is given in Table 14. We compared the frequency of each detected DRB1 allele among the 124 North American patient samples from the AAA study with the frequency of DRBalleles reported for other Canadian and American Caucasian populations in Table 15. The DRB1 allele frequencies observed in this study (Table 15) are similar to those reported for other Canadian and American Caucasian populations (47). Eight DRB3 alleles were identified in the 158 DNA samples. Of 102 DRB3 positive individuals, 16 were DRB3 homozygotes including DRB3*01011 / 12 (n=2), DRB3*0201 (n=2), DRB3*02021 (n=9) and DRB3*0301(n=3). The allele frequency of DRB3(37.5%) in 124 patients enrolled in AAA study is similar to the previously reported Canadian Caucasian populations (47). Three DRB4 alleles, 01011, 01031 and 010312, have identical sequences at exon 2. Since exon 2 polymorphisms are likely to be most relevant to peptide presentation specificity of DRB molecules and we have focused our attention on defining unambiguous sequences from this region. DRB4*01011/01031/01032 is the only DRB4 alleles) identified in this study. Eighty one of 158 samples are DRB4 positive and among them 14 were homozygotes. The allele frequency of DRB4*01011/01031/01032 identified in 124 patients enrolled in AAA study is comparable to that of Canadian Caucasian populations (47). Three DRB5 alleles, 0101, 0102/08N and 0202; were identified. Among 124 DNA samples in AAA study, 37 were DRB5 positive and one was a homozygote. Although the DRB5 allele frequency seems higher in this population than the one reported for Canadian Caucasian populations (47), the DRB5 allele frequency is comparable with the most recent information of HLA Gene and Haplotype Frequencies in the North American Population (100). DRB1-DRB3/4/5 Haplotypes and Linkage Disequilibrium Among the 124 AAA study individuals the deduced DRB1-DRB3/4/5 haplotypes, their frequencies (HP), linkage disequilibrium (LD), and relative linkage disequilibrium (RLD) and x2 value are compared with other Canadian and American Caucasian populations in Table 16 (47). In general, the relative DRB1-DRB3/4/5 haplotype frequencies observed in this study are comparable to those observed in other studies involving subjects of North American Caucasian ancestry. Discussion High resolution typing of exon 2 DNA of DRB genes can be achieved in two steps. With the FSTBSA analysis, low resolution SBT DRB typing can be done with one PCR reaction and one round of sequencing. High resolution of SBT DRB typing can be achieved by sequencing the same PCR products with group specific primers and followed by a Taxonomy-based sequence analysis (TBSA) to resolve the heterozygous alleles. As with any DNA based HLA typing methods the success of the 'Two-step, high resolution DRB typing' depends on the quality of DNA as with any DNA based HLA typing methods. The accurate typing at both low and high resolution depends on even amplification of all functional DRB alleles in the PCR reaction. With the available information of intron sequences adjacent to exon 2 of DRB genes (97, 98), we can evaluate the results of PCR amplifications with the generic primers. In our experience, even amplifications can be achieved by following the PCR conditions (in Methods) and indicated annealing temperature (Table 9), as well as using 100 to 200 ng of starting DNA in a 100 lZl reaction. In general, the purified PCR products from a 100 ul PCRreaction is sufficient for typing all DRB alleles of a given sample at the high resolution level. The first-step taxonomy-based sequence analysis (FSTBSA) of sequence information obtained using generic sequencing primer DRBSEQ4 is very robust. Allele group assignment can be done based on the presence of one or more critical codons for the group. For example, DRB1~'04 group can be assigned if a "CAC" present at codon 33 and DRB4 can be assigned if there is a "AAC" at codon 26. The accuracy of allele group assignment by FSTBSA was confirmed by the second step sequencing with allele group specific primers. Thus, low resolution DRB typing can be done without multiple PCR reactions by PCR-SSP or low resolution typing by serology. Considerable time and money can be saved. Sequencing the same PCR products with group specific primers in the second step and subsequent allele assignment with TBSAmakes the high resolution DRB typing easy in samples of most heterozygous DR haplotypes. In these cases sequencing with group specific primers is to identify one out of four functional DRB alleles, such as in the situation of sample 002 (Table 11). TBSA can also successfully assign alleles in samples where sequencing with group specific primers resulted in heterozygous codon combinations at the polymorphic locus, such as DR3, DR4, 11, 12, 13, and 14 heterozygous haplotypes (see sample 6-1, Table 13). In most cases, a definite allele assignment can be achieved with the aid of confirmation codons after one round of sequencing with group specific primers. In very few cases, additional sequence information with primer (86SEQ) specific for alleles with GTG at codon 86 and 58SEQ primer for alleles have GAG at codon 58, and 26SEQ primer for alleles have TACat codon 26 are required to resolve the ambiguity. The two-step, high resolution DRB typing method is very robust. The first step low resolution typing by FSTBSA can be confirmed by the group specific sequencing at the second step. On the other hand, the high resolution DRB allele assignment by TBSA in the second step can be assisted by the result from the first step. We created DRB typing trees based on the principle of TBSAfor DRB typing. These typing trees (Figure 2-20) can be used for manual DRB typing. We are developing computer programs based on FSTBSAand TBSA, which can be easily updated and make high resolution sequence-based DRB typing an easy task. We anticipate that although manual sequencing was used to develop the two-step, high resolution DRB typing method, the approach can be readily adapted to automatic sequencing. It is important to note, however, that the TBSA method was developed to assign alleles based on known allele databases. In heterozygous situations where new alleles consist of known sequence motifs in different cis/trans patterns, such combinations may not be identified by this method. This remains a common limitation faced by almost all HLA typing and sequence analysis methods. Application of the HLA Typing Method to the Diagnosis and Treatment of Disease The inventors have been studying the potential role of vascular infection with Chlamydia Pneumoniae and the development of abdominal aortic aneurysm (AAA). The inventors have determined that the cases with AAA are more likely to have serum IgG and IgM antibodies to Chlamydia Pneumoniae than are controls without AAA (Blanchard J. et al., Clinical Infect. Disease, in press). The inventors also noted that cases with AAA are more likely to have a family relative with AAA than were controls suggesting that genetic factors also contribute to AAA disease pathogenesis. The inventors used the above new HLA Typing method to determine the relationship of HLA class II genes to AAA pathogenesis. After counting HLA DRB alleles among 90 chromosome from controls and 144 chromosomes from cases the inventors have determined that DRB1*0801 (1/90 vs 5/144) and DRB1*1301 (2/90 vs 5/144) are more common among AAA cases than controls (Luo, M. et al., in preparation). Furthermore subjects with either of these two alleles were more likely to have high titers of serum IgM antibodies to Chtamydia Pneumoniae than were subjects without these genes. Thus, these HLA genes may predispose to Chlamydia Pneumoniae infection (as measured by IgM antibodies) and identify cases with abdominal aortic aneurysm who would be benefitted by antibiotic treatment of their infection. In order to facilitate typing, a computer program has been developed. Referring now to Figure 21, a flowchart of the typing process of the present invention is shown generally as 10. In order to execute process 10, there must exist a sequence database (not shown) and sample DNAinput data (not shown). The sample DNA input data is compared to records in the sequence database to produce typing results. In the preferred embodiment of the present invention, the sequence database is a modified version of the data available from the ImMunoGeneTics human major histocompatibility complex (IMGT/HLA) database. The modified database contains a plurality of sequence records, each record starting from codon 1. Sequences before codon 1 are deleted and any missing sequence information is replaced by three asterisks, i.e. "***". The sequence records are in standard FASTA format. An example of a sequence record is:>DRB3*01014 ************CACGTTTCTTGGAGCTGCGTAAGTCTGAGTGTCATTTCTTCAATGGGA CGGAGCGGGTGCGGTACCTGGACAGATACTTCCATAACCAGGAGGAGTTCCT GCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGGAGCIGGGGCGGCCTG TCGCCGAGTCCTGGAACAGCCAGAAGGACCTCCTGGAGCAGAAG (...) Associated with the database of sequence records is a list of working codons. Working codons are the numbers of the critical typing codons, i.e. the position in each sequence record where a comparison to input data is to be made. Input data consists of a plurality of input records each one having a codon number and one or two codons. For example: ACC GAG GGG CTG GTT (...) As one skilled in the art will recognize, the input data my be created in a variety of ways. To an end user, the method of creation could be via a graphical user interface which permits the user to provide the input data. Alternatively, a programming interface may be provided in which a process passes the input data to the HLA typing process 10 for analysis. Process 10 as disclosed herein has been implemented to type input data based upon HLA sequences, however, the process 10 may be utilized to type any input data given an appropriate database of sequences. Process 10 begins at step 12 where a set of all sequence type entries (Stype) contained in the sequence database are marked as "black". Asequence type entry comprises the codons in a sequence record that match an input record. The use of the term black is meant to indicate a sequence type entry that is not part of the set of final typing results, i.e. no match has been found. Moving next to step 14, any input record that does not appear in any of the sequence records of the database, is deleted from the input data. Moving next to step 16, process 10 matches each working codon in each sequence record of the sequence database to the input records as modified by step 14. At step 18 if a codon match has been found, the corresponding sequence type entry in the set (StyPe) is marked as "red" at step 22 to indicate a possible match. If no match exists,the process moves to step 20 where the sequence entries are marked as black. Both steps 20 and 22 then proceed to step 24. At step 24 if more working codons exist, process 10 returns to step 16. If no more working codons exist, process 10 proceeds to step 26. At step 26, the unused working codons are compared with corresponding entries in the sequence database. If the unused codons do not match a corresponding codon entry, process 10 moves to step 30 wherein the sequence entries are marked as black. If the unused codons do match a corresponding codon entry, process 10 proceeds to step 32. At step 32, the entries in (Stype) are marked as red or yellow and the codon data becomes a used codon. Steps 30 and 32 converge at step 34 where each unused codon is matched with the corresponding codon type entries in the sequence database. Moving next to step 36 a test is made to determine if an unused codon covers any "non-black" group. If this is the case, process 10 moves to step 38 where the unused codon is marked as a used codon.Both steps 38 and 36 converge at step 40 where a test is made to determine if more used codons exist. If they do, process 10 returns to step 34. If no unused codons remain, process 10 moves to step 42 where a test is made to determine if more unused working codons exist. If this is the case, process 10 returns to step 42. If this is not the case, process 10 proceeds to step 44 where the final typing results, i.e. the non-black group within the set (S~e) is displayed to the user or output as data accessible by a process other than process 10. While the present invention has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the invention is not limited to the disclosed examples. To the contrary, the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. FULL CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATION1. Trowsdale J. 1996 Molecular genetics of HLA class I and class II regions. In 'HLA and MHC genes, molecules and function' edited by M.J. Browning and A.J. McMichael. pp.23-38 BIOS Scientific Publishers Ltd, Oxford.2. Hall F.C. and Bowness P. 1996 HLA and diseases: from molecular function to disease association In 'HLA and MHC genes, molecules and function' edited by M.J. Browning and A.J. McMichael.pp.353-381 BIOS Scientific Publishers Ltd, Oxford.3. Thorsby E. 1997 Invited anniversary review: HLA associated diseases. Human Immunol. 53, 1-11 4. Todd JA, Bell JI, McDevitt HO. 1987 HLA-DQ~ gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329, 599-604 5. Bohme J, Carlsson B, Wallin J, et al., 1986 Only one DQ-beta restriction fragment pattern of each DR specificity is associated with insulin-dependent diabetes. J. Immunol. 137, 941-7 6. She J. X. 1996 Susceptibility to type I diabetes: HLA-DQ and DR revisited. Immunology Today 7. Yasunaga S, Kimura A, Hamaguchi K, Ronningen KS, Sasazuki T. 1996 Different contribution of HLA-DR and -DQ genes in susceptibility and resistance to insulin-dependent diabetes mellitus (IDDM). Tissue Antigens 47, 37-48 8. Cucca F, Lampis R, Frau F, et al. 1995 The distribution of DR4 haplotypes in Sardinia suggests a primary association of type I diabetes with DRB1 and DQB1 loci. Hum. Immunol. 43, 301-8 9. Sanjeevi CB, DeWeese C, Landin-Olsson M, et al. 1997 Analysis of critical residues of HLA-DQ6 molecules in insulin-dependent diabetes mellitus. Tissue Antigens 50, 61-65 10. Cisse A, Chauffert M, Cheyenne D, et al. 1996 Distribution of HLA-DQA1 and -DQB1 alleles and DQA1-DQB1 genotypes among Senegalese patients with insulin-dependent diabetes mellitus. Tissue Antigens 47, 333-337 11. Olerup O, Smith CIE, Hammarstrom L 1990 Different amino acid residues at position 57 of the HLA-DQf3 chain are associated with susceptibility and resistance to IgA deficiency. Nature 347, 289-90 12. Olerup O, Smith CIE, Bjorkander J, Hammarstrom L 1992 Shared HLA class II associated genetic susceptibility and resistance to IgAdeficiency and common variable immunodeficiency. Proc. Natl. Acad. Sci. USA 89, 10653-7 13. Reil A, Bein G, Machulla HKG, Sternberg B and Seyfarth M1997 High-resolution DNA typing in immunoglobin A deficiency confirms a positive association with DRB1*0301, DQB1*02 haplotypes. Tissue Antigens 50, 501-506 14. Haegert DG, Michaud M, Schwab C, Tansey C, Decary F, Francis G 1989 HLA-DR beta, -DQ alpha, and -DQ beta restriction fragment length polymorphisms in multiple sclerosis. J. Neurosci. Res. 23,46-54 15. Haegert DG, Francis GS 1992 Contribution of a single DQ beta chain residue to multiple sclerosis in French Canadians. Hum. Immunol.34, 85-90 16. Allen M, Sandberg Wollheim M, Sjogren K, Erlich HA, Petterson U, Gyllensten U 1994 Association of susceptibility to multiple sclerosis in Sweden with HLA class II DRB1 and DQB1 alleles. Hum. Immunol. 39, 41-8 17. Haegert DG, Swift FV, Benedikz J 1996 Evidence for a complex role of HLA class II genotypes in susceptibility to multiple sclerosis in Iceland. Neurology 46, 1107-1111 18. Spurkland A, Celius EG, Knutsen I, Beiske A, Thorsby E, Vartdal F 1997 The HLA-DQ(alpha 1*0102, beta 1*0602) heterodimer may confer susceptibility to multiple sclerosis in the absence of the HLA-DR(a 1*O1, f~ 1*1501) heterodimer. Tissue Antigens 50, 15-22.
19. Saruhan Direskeneli G, Esin S, Baykan Kurt B, Ornek I, Vaughan R, Eraksoy M 1997 HLA-DR and -DQ associations with multiple sclerosis in Turkey. Hum. Immunol. 55,59-65 20. Rigopoulou D, Martinez Laso J, Martinez Tello F, et al. 1994 Both class I and class II HLA antigens are thyroid cancer susceptibility factors. Tissue Antigens 43,281-285 21. Allen M, Kalantari M, Ylitalo N, et al. 1996 HLA DQ-DRhaplotype and susceptibility to cervical carcinoma: indications of increased risk for development of cervical carcinoma in iundividuals infected with HPV 18. Tissue Antigens 48, 32-37 22. Lee JE, Lowy AM, Thompson WA, et al. 1996 Association of gastric adenocarcinoma with the HLA class II gene DQB10301. Gastroenterology 111, 426-432 23. Sastre Garau X, Loste MN, Vincent-Salomon A, et al. 1996 Decreased frequency of HLA-DRB1 13 alleles in Frenchwomen with HPV-positive carcinoma of the cervix. Int. J. Cancer 69, 159-164 24. Dearden SP, Taylor GM, Gokhale DA, et al. 1996 Molecular analysis of HLA-DQB1 alleles in childhood common acute lymphoblastic leukaemia. British J. Cancer 73, 603-609 25. Kageshita T, Naruse T, Hirai S, et al. 1997 Molecular genetic analysis of HLA class II alleles in Japanese patients with melanoma. Tissue Antigens 49, 466-470 26. Lulli P, Grammatico P, Brioli G, et al. 1998 HLA-DR and -DQalleles in Italian patients with melanoma. Tissue Antigens 51, 276-280 27. Just jJ, Abrams E, Louie LG, et al. 1995 Influence of host genotype on progression to acquired immunodeficiency syndrome among children infected with human immunodeficiency virus type 1. J. Pediatr.127, 544-549 28. Just JJ, Casabona j, Bertran J, et al. 1996 MHC class II alleles associated with clinical and immunological manifestations of HIV-1 infection among children in Catalonia, Spain. Tissue Antigens 47, 313-318 ...
29. Tosi R, Vismara D., Tanigaki N, et al., 1983 Evidence that celiac disease is primarily associated with a DC locus allelic specificity.Clin. Immunol. Immunopath. 28, 395-404 30. Sollid LM, Markussen G, Ek J, Gjerde H, Vartdal F, Thorsby E, 1989 Evidence for a primary association of celiac disease to a particular HLA-DQ a/f3 heterodimer. J. Exp. Med. 169, 345-350 31. Velluzzi F, Caradonna A, Boy MF, et al. 1998 Thyroid and celiac disease: clinical, serological, and echographic study. Am. J.Gastroenterol. 93, 976-979 32. Spurkland A, Ingvarsson G, Falk ES, Knutsen I, Sollid LM, Thorsby E 1997 Dermatitis herpetiformis and celiac disease are both primarily associated with the HLA-DQ (alpha 1*0501, beta 1*02) or the HLA-DQ (alpha 1*03, beta 1*0302) heterodimers. Tissue Antigens 49, 29-34 33. Michalski JP, McCombs CC, Arai T, et al. 1996 HLA-DR, DQ genotypes of celiac disease patrients and healthy subjects from the West of Ireland. Tisssue Antigens 47, 127-133 34. Polvi A, Arranz E, Fernandez Arquero M, et al. 1998 HLA-DQ2_Negative Celiac disease in Finland ans Spain. Hum. Immunol. 59, 35. Konrad M, Mytilineos J, Bouissou F, et al. 1994 HLA class IIassociations with idiopathic nephrotic syndrome in children. Tissue Antigens 43, 275-280 36. Rihs HP, Chen Z, Cremer R, Baur X 1997 HLA class II antigens DR4 and DQ8 are associated with allergy to hevein, a major allergen of Hevea latex. Tissue Antigens. 49, 92-5 37. Stephan V, Schmid V, Frischer T, et al. 1996 Mite allergy, clinical atopy, and restriction by HLA class II immune response genes.Pediatr. Allergy. Immunol. 7, 28-34 38. Abe Y, Kimura S, Kokubo T, Mizumoto K, Uehara M, Katagiri M 1997 Epitope analysis of birch pollen allergen in Japanese subjects. J. Clin. Immunol. 17, 485-93 39. Murdoch ME, Payton A, Abiose A, et al. 1997 HLA-DQ alleles associate with cutaneous features of onchocerciasis. Hum. Immunol. 55, 40. Delgado JC, Yunis DE, Bozon MV, et al. 1996 MHC class IIalleles and haplotypes in patients with pemphigus vulgaris from India. Tissue Antigens 48, 668-672 41. Delgado JC, Hameed A, Yunis JJ, et al. 1997 Pemphigus vulgaris autoantibody response is linked to HLA-DQB1*0503 in Pakistani patients. Hum. Immunol. 57, 110-119 42. Santamaria P, Boyce Jacino MT, Lindstrom AL, et al. 1992 HLA Class II "Typing": Direct Sequencing of DRB, DQB, and DQA Genes. Human Immunology 33, 69-81 43. Knipper AJ, Hinney A, Schuch B, Enczmann J, Uhrberg M, Wernet P. 1994 Selection of unrelated bone marrow donors by PCR-SSPtyping and subsequent nonradioactive sequence-based typing for HLA DRBl/3/4/5, DQBl, and DPB1 alleles. Tissue Antigens 44, 275-84.
44. Marsh SGE 1998 HLA class II region sequences, 1998 Tissue Antigens 51, 467-507 45. Marsh SGE 1998 HLA class II region sequences, 1998, Anthony Nolan Research institute, (http:/ /www.anthonynolan.com/HIG/data.html).
46. Imanishi T, Akaza T, Kimura A, Tokunaga K, and Gojobori T1992 Estimation of allele and haplotype frequencies for HLA and complement loci. In HLA 1991. pp. 76-79 47. Imanishi T, Akaza T, Kimura A, Tokunaga K, and Gojobori T1992 Allele and haplotype frequencies for HLA and complement loci in various ethnic groups. In HLA 1991. Proceedings of the eleventh international histocompatibility workshop and conference. pp. 1065-1220 48. Olerup O, Aldener A, Fogdell A 1993 HLA-DQB1 and -DQA1 typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Tissue Antigens 41, 119-34 49. Jasson A K, Hyldig-Nielsen JJ, Servenius B, et al. 1987 Class IIgenes of the human major histocompatibility complex. Comparison of the DQ and DX a and Q genes. J. Biol. Chem. 262, 8767-8777 50. Ma Luo, Jamie Blanchard, Ian Maclean and Robert Brunham Identification of A Novel DQB1 Allele, DQB1*0616. (Submitted to Tissue Antigens) 51. Ma Luo, Jamie Blanchard, Ian Maclean and Robert Brunham Identification of A Novel HLA-DQA1 Allele (DQA1*0106) by sequence-based DQAl typing. (Submitted to Tissue Antigens) 52. Voorter C.E.M., Kik M.C., and van den Berg-Loonen E.M.1998 High-resolution HLA typing for the DQB1 gene by sequence-based typing. Tissue Antigens 51, 80-87 53. Schreuder GM, Hurley CK, Marsh SG, Lau M, Maiers M, Kollman C, Noreen H 1999 The HLA dictionary 1999: a summary of HLA-A, -B, -C, -DRB1/3/4/5, -DQB1 alleles and their association with serologically defined HLA-A, -B, -C, -DR and -DQ antigens. Tissue Antigens 1999 54, 409-37 54. The MHC sequencing consortium. Complete sequence and gene map of a human major histocompatibility complex. Nature 401, 921-55. Serjeantson S.W. and Easteal S. 1991 Cross-ethnic group comparisons of HLA class II alleles and insulin dependent diabetes mellitus. Bailliere's Clin Endo.Metab. 5, 299-320 56. Sanjeevi CB, HooK P, Landin-Olsson M, Kockum I, Dahlquist G, Lybrand TP and Lernmark A 1996 DR4 subtypes and their molecular properties in a population-based study of Swedish childhood diabetes. Tissue Antigens 47, 275-283 57. Chuang LM, Wu HP, Chang CC, Tsai WY, Chang HM, Tai TYand Lin BJ 1996 HLA DRB1 /DQA1 /DQB1 haplotype determines thyroid autoimmunity in patients with insulin-dependent diabetes mellitus. Clinical Endocrinology 45, 631-638 58. Dubois-Laforgue D, Timsit J, Djilali-Saiah I, Boitard C and Caillat-Zucman S 1997 Insulin-dependent Diabetes mellitus in non-DR3/non-DR4 subjects. Human Immunology 57, 104-109 59. Undlien DE, Friede T, Rammensee H-G, Joner G, Dahl-Jorgensen K, Sovik O, Akselsen HE, Knutsen I, Ronningen K and Thorsby E 1997 HLA-encoded genetic predisposition in IDDM. DR4 subtypes may be associated with different degrees of protection. Diabetes 46, 143-149 60. Sanjeevi CB, Hagopian WA, Landin-Olsson M, Kockum I, Woo W, Palmer JP, Lernmark A and Dahlquist 1998 Association between autoantibody markers and subtypes of DR4 and DR4-DQ in Swedish children with insulin-dependent diabetes reveals closer association of tyrosine pyrophosphatase autoimmunity with DR4 than DQB. Tissue Antigens 51, 281-286 61. Shtauvere A, Rumba I, Dzivite I and Sanjeevi CB 1998 HLA-DR and -DQ gene polymorphism in Latvian patientd with insulin-dependent diabetes mellitus. Tissue Antigens 52, 385-388 62. Ono T, Zambenedetti MR, Yamasaki K, Kamikawaji N, Ito H, Sakurai M, Nishimura Y, Kira J, Kanazawa I and Sasazuki T 1998 molecular analysis of HLA class I (HLA-A and -B) and HLA class II (HLA-DRB1) genes in Japanese patients with multiple sclerosis (Western type and Asian type). Tissue Antigens 52, 539-542 63. Carcassi C, Cottoni F, Florin L, Vacca A, Mulargia M, Arras M, Boero R, La Nasa G, Ledda A, Pizzati A, Cerimele D and Contu L 1996 HLAhaplotypes and classII molecular alleles in Sardinian and Italian patients with pemphigus vulgaris. 1996 Tissue Antigens 48, 662-667 64. Mobini N, Yunis EJ, Alper CA, Yunis JJ, Delgado JC, Yunis DE, Firooz A, Dowlati Y, Bahar K, Gregersen PK and Ahmed AR 1997 Identical MHC markers in non-Jewish Iranian and Ashkenazi Jewish patients with Pemphigus vulgaris: possible common central Asian ancestral origin. Hum. Immunol. 57, 62-67 65. Gonzalez-Escribano MF, Jimenez G, Montes M, Perez-Bernal AM, Rodriguez MR, Conejo-Mir JS, and Nunez-Roldan A 1998 Distribution of HLA class II alleles among Spanish patients with pemphigus vulgaris. Tissue Antigens 52, 275-278 66. Yamashina Y, Miyagawa S, Kawatsu T, Lida T, Higashimine I, Shirai T and Kaneshige T 1998 Polymorphisms of HLA class II genes in Japanese patients with pemphigus vulgaris. Tissue Antigens 52, 74-77 67. Miyagawa S, Amagai M, Niizeki H, Yamashina Y, Kaneshige T, Nishikawa T, Shirai T and Inoko H 1999 HLA-DRB1 polymorphisms and autoimmune responses to desmogleins in Japanese patients with pemphigus. Tissue Antigens 54, 333-340 68. Sastre-Garau X, Loste MN, Vincent-Salomon A, et al. 1996 Decreased frequency of HLA-DRB1 13 alleles in Frenchwomen with HPV-positive carcinoma of the cervix. Int. J. Cancer 69, 159-164 69. Price P, Calder DM, Witt CS, Allcock RJN, Christiansen FT, Daves GR, Cameron PU, Rogers M, Baluchova K, Moore CB and French MA 1999 Periodontal attachment loss in HIV-infected patients is associated with the major histocompatibility complex 8.1 haplotype (HLA-A1, B8,DR3). Tissue Antigens 54, 391-399 70. Reinshagen M, Loeliger C, Kuehnl P, Weiss U, Manfras BJ, Adler G and Boehm BO 1996 HLA class II gene frequencies in Crohn's disease: a population based analysis in Germany. Gut 38, 538-542 71. Forcione DG, Sands B, Jsselbacher KJ, Rustgi A, Podolsky DKand Pillai S 1996 An increased risk of Crohn's disease in individulas who inherit the HLA class II DRB3*0301 allele. Proc. Natl. Acad. Sci. USA 93, 72. Yoshitake S, Kimura A, Okada M, Yao T and Sasazuki T 1999 HLA class II alleles in Japanes patients with inflammatory bowel disease. Tissue Antigens 53, 350-358 73. Rumba I, Denisova A, Sochnev A, Nilsson B and Sanjeevi CB 1997 HLA class II genes in Latvian patients with juvenile rheumatoid arthritis. Tissue Antigens 49, 56-60 74. Yukioka M, Wakitani S, Murata N, Toda Y, Ogawa R, Kaneshige T and Ochi T 1998 Elderly-onset rheumatoid rethritis and its association with HLA-DRB1 alleles in Japanese. Brit. J Rheumatol. 37, 98-75. Fugger L and Svejgaard A 1997 The HLA-DQ7 and -DQ*associations in DR4-positive rheumatoid arthritis patients. Tissue Antigens 50, 494-500 76. McDermott AB, Zuckerman JN, Sabin CA, Marsh SGE and Madrigal JA 1997 Contribution of human leucocyte antigens to the antibody response to hepatitis B vaccination. Tissue Antigens 50, 8-14 77. Westman P, Hashemi-Tavoularis S, Blanchette V, Porcelijn Land Kekomaki R 1997 Maternal DRB1*1501, DQA1*0102, DQB1*0602 haplotype in fetomaternal alloimmunization agaist human platelet alloantigen HPA-6b(GPIIIa-G1n489). Tissue Antigens 50, 113-118 78. Howell WM, Standring P, Warner JA, Warner JO 1999 HLAclass II genotype, HLA-DR B cell surface expression and allergen specific IgE production in atopic and non-atopic members of asthmatic family pedigrees. Clin Exp Allergy Suppl 4:35-8 79. Howell WM, Turner SJ, Hourihane JO, Dean TP, Warner JO1998 HLA class II DRB1, DQB1 and DPB1 genotypic associations with peanut allergy: evidence from a family-based and case-control study. Clin Exp Allergy 28,156-62 80. Horton H, Weston SD, Hewitt CR 1998 Allergy to antibiotics: T-cell recognition of amoxicillin is HLA-DR restricted and does not require antigen processing. Allergy 1998 53, 83-8 81. Matsuoka H, Uno H, Kawano K, Tsuda K, Tsubouchi H 1996 MHC class II restriction for T cell proliferative response to mite antigen. Ann Allergy Asthma Immunol 77, 191-6 82. Hirose H, Takagi M, Miyagawa N, Hashiyada H, Noguchi M, Tada S, Kugimiya T, Tilson MD 1998 Genetic risk factor for abdominal aortic aneurysm: HLA-DR2(15), a Japanese study. J Vasc. Surg. 27, 500-503 83. Rasmussen TE, Hallett JW Jr, Metzger RL, Richardson DM, Harmsen WS, Goronzy JJ, Weyand CM 1997 Genetic risk factors in inflammatory abdominal aortic aneurysms: polymorphic residue 70 in the HLA-DR B1 gene as a key genetic element. J Vasc. Surg. 25, 356-64.
84. Tilson MD, Ozsvath KJ, Hirose H, Xia S 1996 A genetic basis for autoimmune manifestations in the abdominal aortic aneurysm resides in the MHC class II locus DR-beta-1. Ann N Y Acad Sci. 800, 208-15.
85. Shindo Y, Ohno-S, Nakamura-S, Onoe-K, Inoko-H 1996 Asignificant association of HLA-DPB1*0501 with Vogt-Koyanagi-Harada's disease results from a linkage disequilibrium with the primarily associated allele, DRB1*0405. Tissue Antigens 47, 344-345 86. Lavard L, Madsen HO, Perrild H, Jacobsen BB and Svejgaard A 1997 HLA class II associations in juvenile Graves' disease: indication of a strong protective role of the DRB1*0701, DQA1*0201 haplotype. Tissue Antigens 50, 639-641 87. Vejbaesya S, Eiermann TH, Suthipinititharm P, Bancha C, Stephens HA, Luangtrakool K, Chandanayingyong D 1998 Serological and molecular analysis of HLA class I and II alleles in Thai patients with psoriasis vulgaris. Tissue Antigens 52, 389-392 88. Spurkland A, Saarinen S, Boberg KM, Mitchell S, Broome U, Caballeria L, Ciusani E, Chapman R, Ercilla G, Fausa O, Knutsen I, Pares A, Rosina F, Olerup O, Thorsby E, Schrumpf E 1999 HLA class II haplotypes in primary sclerosing cholangitis patients from five European populations. Tissue Antigens 53, 459-469 89. Hirayama K, Chen H, Kikuchi M, Yin T, Gu X, Liu J, Zhang S, Yuan H 1998 HLA-DR-DQ alleles and HLA-DP alleles are independently associated with susceptibility to different stages of post-schistosomal hepatic fibrosis in the Chinese population. Tissue Antigens 53, 269-274 90. Eiermann TH, Bettens F, Tiberghien P, Schmitz K, Beurton I, Bresson-Hadni S, Ammann RW, Goldmann SF, Vuitton DA, Gottstein B, Kern P 1998 HLA and alveolar echinococcosis. Tissue Antigens 52, 124-129 91. Apple RJ and Erlich HA 1996 HLA class II genes: structure and diversity. In 'HLA and MHC genes, molecules and function' edited by M.J. Browning and A.J. McMichael. pp.96-112 BIOS Scientific Publishers Ltd, Oxford.
92. Kaneoka-H; Lee-DR; Hsu-KC; Sharp-GC; Hoffman-RW 1991 Solid-phase direct DNA sequencing of allele-specific polymerase chain reaction-amplified HLA-DR genes. Biotechniques 10, 30-34.
93. Spurkland A, Knutsen I, Markussen G, Vartdal F, Egeland T, Thorsby E. 1993 HLA matching of unrelated bone marrow transplant pairs: direct sequencing of in vitro amplified HLA-DRB1 and -DQB1 using magnetic beads as solid support. Tissue Antigens 41,155-164 94. McGinnis MD, Conrad MP, Bouwens AG, Tilanus MG, Kroruck MN 1995 Automated, solid-phase sequencing of DRB region genes using T7 sequencing chemistry and dye-labeled primers. Tissue Antigens 46,173-179 95. Voorter CE, de-Bruyn-Geraets D, van-den-Berg-Loonen EM1997 High-resolution HLA typing for the DRB3/4/5 genes by sequence-based typing. Tissue Antigens 50, 283-90 96. Voorter CE, Rozemuller EH, de-Bruyn-Geraets D, van-der-Zwan AW, Tilanus MG van-den-Berg-Loonen EM 1997 Comparison of DRB sequence-based typing using different strategies. Tissue Antigens 49, 471-476 97. Blasczyk R, Kotsch K, Wehling J 1998 The nature of polymorphism of the HLA-DRB intron sequences is lineage specific. Tissue Antigens 52, 19-26 98. Kotsch K, Wehling J, Blasczyk R 1998 Sequencing of HLAclass II genes based on the conserved diversity of the non-coding regions:sequencing based typing of HLA-DRB genes. Tissue Antigens 53, 486-497 99. Luo M, Blanchard J, Pan Y, Brunham K, Brunham RC 1999 High-resolution sequence typing of HLA-DQA1 and -DQB1 exon 2 DNAwith taxonomy-based sequence analysis (TBSA) allele assignment. Tissue-Antigens 54, 69-82 100. Mori-M; Beatty-PG; Graves-M; Boucher-KM; Milford-EL 1997 HLA gene and haplotype frequencies in the North American population: the National Marrow Donor Program Donor Registry. Transplantation.1997 64,1017-27 v ~ U U V U U U U U Ua es 0 0 0 0 0 0 0 0 0 ~ G av H N~ O G O ~nO o o O W G M O O O a N ~ O~ N ~ H N H O G G G G G G G G G O O O O O O O O O O o O G ~ ~ C O a a v v ih M G~ ~ C~ M C~ M Ua~ , C7M d a ~ a E d ~ ~ ~ U a C V C7 C V E.77 , v a Q C7 U H H U C7U aa V v U ~ U ~ E. C7 U U U Hcn H H ., C7 ~ H ~ a V U ~ U U a ~ v ~ U -~ E. Wf~U E~Q d (- Ud GJ ~Q U C U~ E"" C~( 7 U E..U . H a Ua d U U C~ U ~ U H U f- H U U p ~ C~ C7 U H C7C7 U inin in in in ininin in cd a ..., C p OD ODm m G G Ca.. 'v 'u ' ' 'v y y ~ y . ~ '~ u u . y N m y m .~ . ~ ~ap .,. + G . G G pG G p, Q'm~~ ~~ w 8'~ cn r,,~ v...d.. v..y d... H H ' 'a cn '~ cn " ~ w a d ~, d~ coco. r~o~d Or d~ Q~ ~ Orr~a~ A p On;On" Ot A A Or O~~,~~" ~" a M Ca A G ~ M G Aa. a, a, a, a, a a a ~ d a a 'w w w z z w w z z AQ Q d ~ ~ ~ rya z A a a a a a a a A p L~ A A A A O A Oz ~ cV m ~ u7 .pn ~ o~.~ a w Table 2. DQ allele and haplotype assignment from the 10 control samples ple DQA1 DQBhaplotype No. Q /02, 01 D D DQA 1 *0201/DQB ~0 O 1/02 A I *0101%04/05; B *0501 2 DQA DQBDQA 1 *0301 I /02/03/DQB 1 I *03011/OZ/03; 1 *0302 *0302; DQA 1DQBDQA 1 *03011/OZl03/DQB 1.*0301 I *03032 //02/03*03032 QDQ B 1 *03032DQA 1 *0103/DQB 1 *0603 D DQBDQA 1 *0201/DQB 1 *03032 A 1 *0103 1 Q 0603; 4 DQA DQBDQA 1 *0201/DQB 1 *0201/02 1 *0201; 1 *0201/02; DQA 1 DQB DQA 1 *0501 II13/03/DQB 1 *05011/I3/03; 1 *0~201/02 . *0201 /02; DQA I DQBDQA 1 *01 O I/04/OS/DQB 1 *0101/04/O5; 1 *OSO 1 *0501 DQA 1 DQBDQA 1 *0101/04/OS/DQB 1 *0501 *0101/04/05; 1 *0501 6 DQ A 1 *0101/04/O5;DQBDQA 1 *O1 O 1/04/05/DQB 1 1 *OSO 1 *0201/02; DQA 1 DQB DQA 1 *05011/13/03/DQB 1 *0201/02 *05011/13/03 1 *0501 DQA 1 DQBDQA 1 *05011/13/03/DQB 1 *03032 *0101/04/05; 1 *03032 DQA 1 DQBDQA 1 *0101/04/OS/DQB 1 *0602 *OSO11/13/03; 1 *0602 DQA 1 DQBDQA 1 *0201/DQB 1 *03032 *0201; I *03032 DQA I DQBDQA 1 *0I021/22lDQB 1 *0602 *01021/22; I *0602 DQA1 *03011/02/03; DQB 1 *03011 DQA 1 *03011/02/03/DQB I *03011 DQA 1 *0301 //02/03; DQB 1 *0302 DQA 1 *03011/02l03/DQB 1 *0302 DQA 1 *0103; DQB 1 *0603 DOA 1 *0102~Q2mOR ~ nSna DQA I 01021 /22;Table 4a. DQA 1 heterozygous allele combinations detected in 134 DNA samples alleleg ~ ~ ~ ~ ~ "w oiov04ros 13 5 76 2 oioZinZ # 2 6 132 11 oio3# ' 6 1 1 2 oio6I oioi # # # 5 2 8 1 03011/0 1~03# # # # # 1 I ~ 0401# # # #3 osoivi3rus# # # # # #4 osoiz # # ##: Heterozygous allele combinations were detected.- The Arabic numbers indicate the number of patient DNA samples.- The 134 DNA samples include 10 healthy controls. Six DNA samples were excluded due to contamination or insufficient amount of DNA.*: The new DQA 1 allele identified during this study (51 ). Table 4b. DQB I heterozygous allele combinations detected in 135 DNA samples allele ~ ~ ~ ~ 15 . ~ IS ~ oiolroz g 4 6 4 5 2 2 1 l0 1 1 oio3 I 03011 #6 1 2 5 15 1 II 0302# # 2 1 1 4 2 141 1 o3o3z # # #1 4 3 I I 0304 # 0402 # # # 1 1 1 osol# # # # 14 1 1 2 osoZ## # 05031 # # ## 1 06011 # oso2# # # # # # # 1 I 0603# # # # # ## # 2 0604 # ##.## # 0607# #0609 ## 0611 #0616' # #: Heterozygous allele combinations were detected.- The Arabic numbers indicate the number of patient DNA samples.- The 135 DNA samples include 10 healthy controls. Five DNA samples were excluded due to contamination or insufficient amount of DNA.*: The new DQB 1 allele identified during this study (50). i , Table 5. Comparison of sequences of DQB1 and DQB2 at the primer sites Name 5'-end primer site calculated 3'-end primer site calculated TM ( ~G7 TM ('C) DQB1 s'~TCCCCGCAGAGGATTTCGTG3' 61.9 3'-GAGGTGAGCGTCGTCGCC~5' 64.1 DQB2 S'~TCTCCGCAGAGGATTTC~,TG-3' , 'r7~8 ~'.~AGGTGAGCGTCGTCGTC~S' 59.6 Table 6. DQA 1 and DQB 1 allelic and phenotypic frequencies DQADQB1t ele No. gophenotype~yo allele No. 96 Phenotypeoho 0101/0410541 15.30 37 27.610501 32 11.44 28 20.74 01021/22 47 17.53 47 35.070502 51.85' S 3.70 0103 12 4.48 I2 8.96 05031 62.21 6 4.44 0106* 10.37 1 0.74 0504 10.37 1 0.74 0201 37 13.81 35 26.1206011 I0.37 I 0.74 03011/02/0350 18.66 . 4432.840602 33 12.55 32 23.70 ~ 0401 13 4.85 11 8.21 0616* I0.37 1 0.74 0501/113/0360 22.39 52 38.810603 11 4.06 11 8.15 05012 72.61 7 5.22 0604 93.32 8 5.93 Total 268 0607 20.74 2 1.48 0609 31.13 2.22 0611 10.37 1 0.74 0201/2 60 22.14 51 37.78 0203 10.37 1 0.74 03011 43 16.24 37 27.41 0302 27 9.96 27 20.00 03032 21 7.75 20 14.81 0304 31.12 1.48 0402 10 3.69 10 7.41 Total 270 * The new DQB 1 and DQA 1 alleles identified in this study (50, 51 ). Table Comparison DQA1 allele 7. of and frequencies DQB of 1 individuals in this study with other Caucasians American and Canadian allele this studyAmerican _ _ CanadianAmerican Canadian allele ~ls study 0101/04/0515.30 13.9 14.40501 11.44 8.4 12.5 01021/2217.53 15.3 11.90502 1.851.4 1.0 0103 4.48 6.0 7.3 05031 2.211.4 1.1 0106* 0.37 - - 0504 0.370.0 0.0 0201 13.81 13.3 15.406011 0.371.4 2.4 03011/02/0318.66 21.2 18.80602 12.55 11.46.5 0401 4.85 ~ 1.9 3.0 0616* 0.37-05011/13/0322.39 24.6 20.7 0603 4.066.7 7.6 05012 2.61 0.0 0.00604 3.323.3 1.6 03012 0.00 0.8 I.1p6p7 0.74- _ 0601 0.00 0.0 0.00609 1.1 -0611 0.37- _ 0201/2 22.14 25.724.3 0203 0.37--03011 16.24 20.016:0 0302 9.9612.08.1 03032 7.753.9 0.0 0304 1.1 - -0402 3.691.6 2.4 05032 0.000.0 0.5 0605 0.000.5 0.5 03031 0.000.3 0.0 0401 0.000.8 0.8 * The new DQB 1 and DQA 1 alleles identified in this study (S0, 51 ). i ' ~ .~ , Table 8. Comparison of DQA1~DQBl hapiotype frequencies of patients ill this study with other American and Canadian Caucasians haplotype This LD RLD x= Canadian LD RLD x= American LD RLD x2 study x 100 __._ __ ___ DQAI0101/04/052.24 1.90 1.021.4 l.2 L00 32.2 34.55 DQAIOIOII04I050.75 -1.170.09 . DQAl0101/041~050.75 0.I2 0.03 DQAI0101/04~050.37 -0.140.01 DQAI 01021~Z0.37 1.680.1 I DQAI01021/2 1.49 1.16 0.761.4 l.2 l.00 283 . I DQAI0102112 037 0.30 ' 1.07 DQBl0501 DQAI0101112 11.57 9.320.909.5 7.8 0.80 169.02.82l 0.3625.6 144.6 DQAI0102112 0.37 0.30 1.07 ~ DQBl0616 DQAIOI062.61 2.02 0.742.8 2.3 0.82 ~ 1.6IS 1.0047.5 23.26 47.1 DQAl01021~1 1.1I 0.92 L.02 14.17 DQAl020110.07 7.010.949.4 5.8 0.57 54.310.4 7.0 0.6579.7 131.8 DQBl020112 DQAl02013.36 2.29 0.342.5 1.9 0.58 30.5 DQBl03032 DQAl0201037 -1.2 O.10 DQAI03011/13/034.85 l.82 0.1410.4 6.0 0.38 47.54.5l.5 O.ll3.9 4.29 DQAI0301L1310310.07 B.210.01936.8 0.74 94.25.74.2 0.6054.3 132.8 DQAI03011/131032.24 L97 0.31 9.57 DQAI0301I/13l03LIZ 0.91 LOl 13.45 DQAl03011/13103037 -0.ZS 0.01 DQBI'0604 DQAI'0401 3.73 335 LOl 205.91.4 L4 0.832.221 0.85196.2 249.7 DQBl0402 DQAI04010.37 -0.700.03 DQAI04010.37 -0.030.07 DQAI04010.37 0.27 O.13 DQBl0502 DQAl0501L13/0310.82 7.18037 58.448.2 0.2110.4 6.8 0.52 3.2 12.2 71.3 DQBl 03011 Table s. Comparison of DQAl-DQBl haplotype frequencies of patients in AAA study with other American and Canadian Caucasians (continue) haplotype ThLs LD RLD X= Canadian LD RLDAmectcaa LD RLD X= = studyxX loo x loo x loo DQAI'OSO1L13J03 10.455.490.3227.0215.7 9.4 0.51 89.5 . DQBI'020112 . . 4.3 DQAI05011/I3J03 0.37 0.290.023.58 . DQAIOSOlUi3/03 0.95 -0.980.01 DQAI05012 0.75 0.170.01 DQAIOS012 1.12 0.540.27 DQBi020112 DQAi05012 037 -0.OS0.32 DQBi03011 , DQAiOSOi2 0.37 0.36: ~~L00 DQBi0611 DQAI0103 3.36 3.180.821623 S.S S.l 0.91 2623 4.1 3.5 0.49 85 DQBI0603 . DQAI0103 0.95 0.721.0244.21 DQBl0607 DQAI0103 0.37 0.361.0221.98 *: The new haplotypes identified in this study. G '~ 'G27'~ '~"C3'T3'O 'O'b'L3'O 'O 'TJ'O T3 = C G G G G G G G G G G G G G C Gv , O O O O O O O O O O O O O O O O V U V V V V U V V V V U VU V 4Jv N N v v 4J4J 4J N 4J v v v 41 U~~ ~ N ~ N v7 4)rlW V) X11N N V~ O O O O O O O O O O O O O O O O M M M M M M M M M M M M M M M MOA~' G ~ , U V U V V U V U V V V V U U V Uro 0 0 0 0 0 0 0 0 0 ~"y 0 0 0 0 0 0 0 d~ O O W 00 M ~D O d tf~~ ~ Lw OvO ~ ~ ~ ~D ~D ,~, ~ W O ~ ~ W ~ ~ ~ ~ ~ tn n O 4!(~ r, O G 0 0 ~ ~~mM o N ~ ~ ~n c'.i ~rN M ,", V V~ ~ N ~ V O O O ~~ ~ O O 'a O OO O O O O O N -, N ~ ~ 0~000tn N L~~ ~ N u7 ~ u '~ G G G G G G G G G G G G G G G G O O O O O O O O O O O O O O O O ~ I " 't7'O"O '~ ~O'Lf~ 'rS'~ O T3 O~ O O O O O O O O G O O O o O U U V i V V U V V V U V V U M V i u c'n M ( M (7M MM E. h l~H., a M ~,~ a H M M ~ H H ca a Q v ~ H a ~ v ~ ~ ~ a ' cn ~ ~ ~ ~ V d,'~ ~ C7 C7~ ~" U ~ ~ V Q ~ ~Q ~ ~ H H ~ E.., v U U ~Q ~ ( U V C7~ Q U U 7 .7 U C7 C. U U U C7 ~ ~ E.QV H H ~ U Q V V, ~. . ~ U H V U H U ~ H U U H H V C7 U ~~ C7 C7 E-~F-~~ U U C7~ ~ U ~ ~ ~ ~ V C7 V U U HU Q H -~C7U Q C7 ~ U C~ U ~ UE E-~~ U C7 Q H Q U (--~Q U ~ ~ F-~V (-7V f-~Q C7H U U H U U C7 V U Q H in ininireinin~ in inininin irein in M v v vi N ~ Q U ~ '~' H ' v ' C7 C7 vo ~ ~ ao 'L~~ ~ ~ di 0~0~n 'CS~.,.C ~..i '~ O~ ~ ~ N' ' C . . M ~ G ~ ~ ~. o0 G G G G m* 30 30 30 0 ~ o M ~ ~ ~ Ts ca m m as as r~c0w co as r~ m r~~ O o o ca p w ~' x x x x xx x p ~ ~ p N p p p p p pp p p p ~~a o c a w a ~a M a a ~a a w x ,~ ~ a a a a a x a a a ~ ~ ~ ~ ~ w w w w U W W w ,..~M en oow cncn cn ~o ~o ~o z o. w ~ncn cno 0 0 0 ~ M as ~ rx x rxx ~ rxx x x x x x x c~ rx p p p p p p p p p p p p p p p p I p . ' O ~ N M V~~ up N o0O~O ~ N M d' i ~ -a,-,~r ,~ ,--ie~N N N N N N wz Table 10 . Critical colons for classification of DRB allele arouns DRB allele group critical colonsDRB allele group critical colons DRBl*Ois: *codon 14 GAA DRBi*08 *codon 12 AGG/ATG *codon 30 TGC*codon 57 ATC *codon 45 AGGcolon 13 GGT colon 13 TTT colon 16 TAT colon 26 TTGcolon 57 GTT colon 28 GAAcolon 74 CTG colon 69 GAA colon 70 GAC DRB1*i5s and 16s: *codon 11 CCT DRBi*09s:*Codon 9 AAG *codon 13 AGG *codon 26 TAT *codon 50 GCGcolon 28 CAC *codon 30 AATcolon 30 GGC *codon 72 GCCcolon 60 TCC *codon 27 CCGcolon 78 GTG colon 8 CTG DRBl*1001*codon 10 GAG colon 84 GGA *codon 31 GTC *codon 72 CGT DRBl*03s: colon 71 AAGDRBl*iis *codon 59 GAC colon 73 GGC*codon 74 GTG colon 10 TACcolon 58 GAG colon 34 CAG/CGG) colon 26 TTC colon 13 TCTcolon 19 AAT DRBl*04s: *codon 33 CAC DRB1*12s *codon 26 GGA *codon 35 GAA *codon 37 CTC *codon 39 CGGcolon 13 GGT *codon 49 GTG colon 28 GAG *codon 51 ATG colon 30 CAC *codon 59 CAG colon 34 CAG *codon 58 ACCcolon 72 CGC *codon 71 CAG colon 11 GTT colon 12 AAAcolon 19 AAC DRBl*07s: *codon 11 GGT DRBi*13a * colon 86 GAT *codon 14 AAG *oodon 48 CTG *~don 29 AGTcolon 10 TAC *codon 30 CTC colon 13 TCT, *codon 53 CTA GGT(1317) colon 19 AACcolon 70 GAC colon 25 CAGcolon 58 GCC . colon 78 GTG . DRBl*14s *codon 16 CAA Table 10 . Critical colons for classification of DRB allele groups (continue DRB allele group critical colons DRB allele group critical colons DRB3 *codon 51 AGG DltB4 *codon 28 ATC (all), *codon 77 AAT *codon 26 AAC *codon 11 TGT and CGT *codon 18 CTC colon 10 CTG *codon 11 GCT colon 73 GGC *codon 13 TGT colon 71 AAG*codon 23 CGA *codon 25 TGG *codon 81 TAC *codon 41 AAC *codon 42 AGT *codon 44 CTG *codon 48 CAG *codon 81 TAC DRBS *codon 9 CAG (all), *codon 11 GAT (all), *codon 30 GAC (some), colon 28 CAC (all), colon 26 TTC (all), colon 19 AAC (all), colon 13 TAT (all) - The colons with a "*" exist only in the specified DItB allele group. However, not all alleles in the group have these colons.- The colons without a "*" exist in the specified allele group and in a few other D1ZB allele groups. a.7 ~ U ew'~~'a ~ V ~ ,7 C . ~ N M ~ dM' :: "'~~~U N V '~y' H U H D ~r d a>> ~M ~~ ~ a E" ~ U c7 H ~ ac~U a V""'~ N a 'r' Ea U -a V C7 C7 ~w C7 ~ ~ oo U a C7 ~ ~ '~'~' '~' ~ 7 U ~ b ~r O ~ ~ ~ ~ O OO ,' S A~ Ca A i N NDD ea G1. ~ o ~ ~ aQ u a ~ ~~ ~ ~ ~C7U C7~ (Hh EC7., Y' ~ a ~ V 7 ~C7C7 C V C7 C7C7 ~..~ ..,~ ~ V U ~ 7 ' ~ ~F C -~ .a ..H C v y 'o~ ~ ~'U ~ ,7 C7 V C E~ At7C7 C7 U UV ~ U U ra C7U _ C7 C7 't U ~ CU7~ ~ V ~ E a a Y'a a '~ a U Ut-t Ci ~ 7 77 Ca '~U ' V ~ a~ V, E -~N O O O O O i C7U U Q E~ U ~ E.Q...~ t..a..~ ~ ~ C7 a U~ CH7U Q V N C7 'rO Q Hd N C~ ~ ~ U U CO~ U ~~ U U U U U U E..'CV ~ ~ ~ ~' ~ Hdo v~ Q a ~ ~ a (~V I-~U 'V'(~ H A~ H r' U d a C ' ~ ~ UN I-.E- E-~U E E-~ f-~f-~V ~" (U-~OE t-a~~ ~ U a ' H U eb '~a~ '~'aa . ~ a .. ~ ~ ~ ~ ~ '~"~ f-a~U ~ ~ Ca7 _ a ~ a ~ a a c-U H G7~O (7 U ChU eJ t ' ~ g ~ ~ ~ N ~ ~ ~ ~ a ~ ~ a I ~, V U V ~ ~ ~.V. a v a ~ c~ V c~ c~o c~ ~ ° o c~ U U U V ~-. U ~~° H U H ~ ~ °° Ea C7 C7 ~ U Ua f. F.r, Ca,7 U 'C Ca7 ~° ~ '~C O ~ U F~ C7 C7 U V _ U U Ca7 Q ~ °° U f-f-a~ H C~ r a a fU" ~ V U ~ U f-' C7 "' c~ c~ a ~ ~ c~ ~ a '' ~ ~ ~ ~ .Ga v V ~ a ~ ~a t~ w c o~ O U O O~ U ~ ~ ~ ~ o Q.n, ~ ~ ~ ~ ~ ~ ~3 a Ha o ~ ~ c~ ~ ~ 'U~ v z a a ~c oA'~ ~ ~ ~ ~ ~ V a (~ d C7 C5 E. ~ C7 V'' a ~ ~u ~a ~ ~ a ~ v U ~ h Ca,7 ~ °' o C~ ~ °° v ~ ~ b o ~ '° ~ V °° a .c 0 0 ~A I t,, ~ ~'' C7 (~ U a M ~ ~ ~ vwc r v~ a h ~ ~° E", U c~ Va~ E ~ V' N U" M ~ V ~ (7 :~ ('~ ~ V' °'°° ~ H.~" (7 a ono C.v ~. U Mu ~a ~,a ~H ~~'~ ~~ ~c~ M N_ _ H ~ ~ ~C N C7 ~ CJ ~ CJ ~ E" V O A N H.~ ~ N ~, M ~ ef ~ ef ,U v1 ~ ~ ~ ~., b O..n 4.as H ~~ a a ~ ~ ~ _»~a Na ~'U ~UA,a~ C7 U °' b H 00 ~ N ~ M ~ ~ V h U ~~c ~ a ~ E.a, ...c~a,, .... Ch .., ° °~ ° ; 0 0 0 0 0 0 0 0 as _77_ Table 14 . DRB allelic and phenotmic treauencies (AAA stud alleleNo. % phenotype% allele No. /o phenotype DRB1'0101 18 7.26 16 6.64DRBI'100131.21 3 1.2 DRHI'01021l0.4 1 0.41DRBI'1201106 20.81 2 0.83 DRHI'0102210.4 1 0.41DRB1'12021 10.4 1 0.41 DRBI'0103 41.61 4 1.66group total 31.21 3 1.24 group toW 24 9.68 ~ 229.13DRBI'130!72.82 7 2.9 DRBI'0301119 7.66 19 7.88DRBI'130210 4.03 9 3. 3 DRHI'0301220.81 2 0.83DRBI'13031 31.21 3 1.24 DRBI'0305 52.08 5 2.07DRBI'13071 20.81 2 0.83 DRBI'0307 10.4 1 0.41DRBI'131110.4 1 0.41 DRHI'0311 10.4 1 0.41DRBI'131310.4 1 0.41 DRH1'0313 1 0.4 1 0.41DRBi'132710.4 1 0.41 DRBI'03 10.4 1 0.41DRBI'132510.4 1 0.41 ~group total30 12.1 30 12.45DRBI'133110.4 1 0.41 DRBI'0401121 8.47 20 8.3 DRBI'13 10.4 I 0.41 DRBI'0403 31.21 3 1.24group total 28 11.2927 11.2 DRBI'0404 7 2.82 7 2.9 DRHI'l40120.81 2 0.83 DRB 1'041010.4 1 0.41DRB l' 1407 20.81 2 0.83 DRB1'0407 41.61 4 1.66DRBI'1416!0.4 1 0.41 DRBI'0408 31.21 3 1.24DRBI'142110.4 1 0.41 DRH1'0413 10.4 1 0.41DRBI'142610.4 1 0.41 DRB1'0425 10.4 1 0.41DRBI'1430 10.4 1 0.41 group total41 16.5340 16.6group total 83.23 8 3.32 DRBI'0701 35 14.1133 13.69DRBI'15011 32 12.9 31 12.8 DRBI'0801 62.42 6 2.49DRBI'15012 10.4 I 0.41 DRBI'0802110.4 1 0.41DRBI'15021 10.4 I 0.41 DRBI'0803210.4 1 0.41DRBI'16011 20.81 2 0.83 DRBI'0805 10.4 I 0.41DRBI'16021 10.4 1 0.41 DRBI'0806 I0.4 1 0.41DRBI'15 10.4 1 0.41 DRBI'0813 10.4 1 0.41group total 38 15.3237 15.3 DRBI'0817 10.4 I 0.41toW DRBI aUela248 241 group total12 4.84 12 4.98DRB3'010125 10.0823 l/12 DRB1'110116 2.41 6 2.49DRB3'020183.23 6 DRBI'1101310.4 1 0.41DRB3'02021 42 16.9435 DRBI'1102 10.4 1 0.41DRB3'020410.4 1 DRHI'1104193.63 9 3.73DRB3'0301 13 5.24 10 DRBI'1108210.4 1 0.41DRB3'030241.61 4 DRBI'1116 10.4 I 0.41total93 37.5 79 DRBI'1128 1. 0.4 I 0.41DRH4'01011/01031/3278 31.5 67 DRBI'lll9 10.4 1 0.41DRB3'01011 33 13.3132 DRBI'1134 1. 0.4 1 0.41DRBS'020231.21 3 DRHI'll 2O.81 2 0.83DRBS'0102108N10.4 1 group total24 9.68 24 9.96DRBS'10.4 1 DRB1'0901220.81 2 ft fNsl7Q 19'1 t i _78_ Table 15. Comparison of DRB allele frequencies of individuals in this study (AAA samples) with other American and Canadian Caucasians allele this CanadianAmericanallele thisCanadianAmerican study study DItBI'01017.26 5.77.2DRBI'10011.210.32.7 DItHI'010210.41.2' 2.6' DltB1'1201/060.811.51.8 DRBI010220.4 DRBI120210.4 0 0 DRBI'01031.61 0.9i.lgroup total 1.211.51.8 group9.68 7.810.9 DltB1'1301 2.824.74.8 total DRBI'030117.66 12.4' 9.3' DRBI'13024.033.34.4 DRBI030120.81 DRBI'13031 1.211.51.4 DltB1'03020 0.30.3DRBI'13050 0.30.2 DRBI'03032.08 - - DRBI'13071 0.81 -DItBI'03070.4- - DRBI'13110.4-DRBI'03110.4- - DRBI'13130.4 - -DRBI'03130.4- - DRB1'13270.4 - . DRBI'03 0.4- - DRBI1325 0.4 -grouptotsl12.1 12.7 9.6DItBI'1331 0.4 - -DltB1'040118.47 9.86.6DRBI'13 0.4 -DRBI'04031.21 2.91.9group total 11.29 10.6 10.8 DRB 1'04042.82 2.42.5DItB l' 1401 0.811.52.3 DRBI'04071.61 1.3I DRBI'14020 0 0.9 DRBI'04081.21 0.60.3DRBI'14040 0 0.2 DRBI'04100.4- - DRBI1405 0 0.30 DRB1'04130.4- - DRBI'1407 0.81-DRBI0425 0.4 - DRBI'14160.4 --grouptotal16.53 17.3 14 DRBI'14210.4 . DRBl0701 l4.ll 11.1 14.6 DitBl'1426 0.4 . -DRBI'08012.42 1.20.9DRBI'14300.4 - -_ DR81'080210.40 0.3group total 3.231.83.4 D1ZB1'080320.41.20.2DRBI'13011 12.910.9 9.9 DRBI'0804- 0.30.2DRBI'15012 0.4 -DRBI'08050.4. - DltB1'15021 0.4 0.60.7 DltB1'08060.4 - - DRBI'16011 0.811.30.9 DRHI0813 0.4- -DltB116021 0.4 0.60.2 DltB108170.4- - DItBI'15 0.4 group4.84 2.71.8group total 13.32 13.6 11.7 toW DRBI'110112.82.6' 4.2' DRB3'01011/1210.08 15 10.1 DItB l 0.4 DRB3'02013.230.60 DRBI'11020.81 0.61.1DRB3'02021 16.94 16.7 13.4 ~DRBI'11030 0.61.4DRB30204 0.4 . -DItBI'110413.23 2.60.5' DRB30301 5.243.94.1 DItB 1 0.4- - DRB3'0302I .61 - -DRB1'11160.4- - toW 37.536.2 27.6 DItBI11280.4- - DRB4'010J1/01031132.31.337.7 20.7 DltB1'11190.4- . DRBS'01011 13.31 3.42.3 DRBI'11340.4- - 'DRBS'0202 1.210.60 DRBI11 0.81 - - DRBS0102/O8N 0.4 0.30.2 group9.68 6.47.2total13.32 6.32.3 total DRBI'090120.81 1.21.2 - The numbers marked with a "*" represent frequencies of allele typed at lower resolution. Table 16 . Comparison of DRB haplotype frequencies of patients in AAA study with other American and Canadian Caucasians haptotype thisLD RLD ~ Canadian LD RLD American itZLD~ LDstudyx x loo x loo loo DRBI'0101 7.26 DRBI'01021 0.4 DRBI'01022 0.4 DRBI'0103 1.61 DRBI'03011 5.634.870.6790.899.8 7.9 0.76 155 4.7 3.70.44 103.1 DRB3'01011/12 DRBI'03011 1.21-0.160.110.062.6 0.5 0.05 0.5 1.7 1.40.05 0.9 DRB3'02021 DRBI'03012 0.4 0.4 1 121.96 DRB3'0204 DRBI'0305 0.4 0.350.226.07 DRB3'0201 DRBI'0303 1.210.940.7 9.77 DRB3'02021 DRBI'0307 0.4 0.381 18.01 DRB3'0301 DRBI'0311 0.4 0.331 4.88 DRB3'02021 DRBI'0313 0.4 0.36I 9.75 DRB3'01011/12 DRBI'04011 8.746.071.0554.7 DRB4'01011/01031/032 DRBI'0403 1.210.831 6.61 DRB4'01011/01031/032 DRBI'0404 2.821.931 13.65 DRB4'01011/01031/032 DRBl'0407 1.611.1 1 8.82 DRH4'01011/01031/032 DRBI'0408 1.210.83I 6.61 DRH4'01011/01031/32 DRBI'0410 -0.4 0.271 2.17 DRB4'01011/01031/032 DRBI'0413 0.4 0.271 2.17 DRB4'01011/01031/032 DRBl'0425 0.4 0.271 2.17 DRB4'01011/01031/032 DRBI'0701 14.119.671 88.6 DRB4'01011101031/032 DRBI'0801 2.42, DRB1'08021 0.4 DRBI'08032 0.4 DRBI'0805 0.4 DRHI'0806 0.4 DRBI'0813 0.4 DRBI'0817 .0.4 DRBI'09012 0.810.551 4.4 DRB4'01011/01031/032 DRBI'1001 1.21 Table 16, Comparison of DRB haplotype frequencies of patients in AAA study with other American and Canadian Caucasians (continue) haplotype this LD RLD ~CanadianLD RLD~ American ItLD LDstudy x xx 10o 10o 100 DRHI'11011 2.02 1.550.6615.472.62.2 1 46.12.3 1.7 0.4635.2 DRBI'11011 0.81 0.720.2715.09 DRB3'0201 DRHI'11013 0.4 0.331 4.88 DRBI'1102 0.4 0.33I 1.51 0.9 0.7 0.7824.2 DRB3'02021 DRB1'11041 2.82 2.270.8529.122.62.2 1 46.1 DRB3'02021 DRBI'11082 0.4 0.331 4.88 DRBI'1116 0.4 0.331 4.88 DRB3'02021 DRBI'1119 0.4 0.331 4.88 DRB3'02021 DRBl11280.4 0.331 4.88 DRBI11340.4 0.331 4.88 DRB3'02021 DRBI'1201/060.4 0.260.391.51 1.51.2 1 25.30.8 0.6 0.379.3 DRB3'02021 DRBI'1201/060.4 0.390.4929.18 DRBl'12021 0.4 0.391 60.87 DRB3'0302 DRBI13010.81 0.510.172.46 1.71 0.245.4 1.3 0.8 0.188.4 DR83'01011/12 DRBI'1301 2.02 1.870.7 19.782.21.4 0.3510.52.3 1.6 0.3928.2 DRBI'1302 0.4 0.060.020.03 DRB1 1302 0.4 DRB3'02021 DRBI'1302 3.Z3 0.3 0.88131.93 1.7 1.5 0.4 83.1 DRHI'13031 0.81 0.690.6412.01 0.8 0.7 0.5220 ~DRBI13071 0.4 0.260.391.51 DRB1'13071 0.4 0.360.467.95 DRB113110.4 0.391 29.84 DRBI'1313 0.4 0.391 60.87 .DRB1'1323 0.4 0.331 4.88 DRB3'02021 DRBI'1327 0.4 0.391 18.01 g1 _ Table 16. Comparison of DRB haplotype frequencies of patients in AAA study with other American and Canadian Caucasians (continue) haplotype this LD RLD ~ Canadian LD IItLD ~ American LD lftLD 7~study x loo x loo x loo DRBI'13310.4 0.38I 60.87 DRBI'14010.81 0.781 60.67 1.2 0.9 0.76 14.6 DRBI1407 0.81 0.671 9.93 DRB3'02021 DRB11416 0.4 0.331 4.88 DRB3'02021 DRBI'14210.4 0.38I 18.01 DRB3'0301 DRHI1426 0.4 0.260.391.51 DRB1'14300.4 0.36I 9.73 DRB3'01011112 DRB 1' 15011 12.4 11.181 239.23 DRBI'15012 0.4 0.331 6.48 DRBS'01011 DRBl15021 0.4 0.4 1 248 DRBS'0102108N DRBI'16011 0.81 0.8 I 165.35 DRBS'0202 DRBI'16021 0.4 0.4 1 81.32 . Table 17. DRB3 heterozygous allele combinations detected in 158 DNA samples allele 0101/12 020102021020403010302 02021# #1 6 2 0204 # 0301 # # 0302 _ _ _.#~-~ #: lieterorygous allele combinations were detected.- The Arabic numbers indicate the number of patient DNA samples.- The 158 DNA samples include 10 healthy controls. Table 18 ,..DRB1*03, 08, 11, 12,13,14 beterozyeous allele combinations detected in 158 DNA samples ~ N W..~N M ~.N~ ~ v.r ~ ~ Yit~~ M ~ '~~O0DM t~~ ~ ~N 00~OCv~ ~ N ~ N M t'w m r W r O O O OO ~ ~ O O O O..mr.~O C CO ~ O ~ ~M O O O O ~ ~ M O N t~f M M e~fM M M 000000000000nn~ ..,.,,..,,.,w ..~,."N N ~ M !h~thM erfe!'~!er O O OO O O O O O OO O ~ ~ ~.~~ .~~r~~ rrw .q~ ~ ~~ .~,~,..~,~,.,i ~1= 1 1 2 1 #2 21 0311 # osoal11 osos o~ 0813 # 11011##11 1 (loll # 1102 # #11041# 1 Ilosz # 1201/06## 12011# 1301 # #2 1 1302 # # ## # 13031# # #13071 #1311 # 1315#1407 # # 1430 # SEQUENCE LISTING(1) GENERAL INFORMATION:(i) APPLICANT: The University of Manitoba (ii) TITLE OF INVENTION: Method for HLA Class II Typing (iii) NUMBER OF SEQUENCES: 25 (iv) CORRESPONDENCE ADDRESS:(A) ADDRESSEE: BERESKIN & PARR(B) STREET: 40 King Street West (C) CITY: Toronto (D) STATE: Ontario (E) COUNTRY: Canada (F) ZIP: M5H 3Y2 (v) COMPUTER READABLE FORM:(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:(A) APPLICATION NUMBER: CA 2,299,675 (B) FILING DATE: 10-MAR-2000 (C) CLASSIFICATION:(vii) PRIOR APPLICATION DATA:(A) APPLICATION NUMBER: US 60/124,113 (B) FILING DATE: 12-MAR-1999 (viii) ATTORNEY/AGENT INFORMATION:(A) NAME: Gravelle, Micheline (B) REGISTRATION NUMBER: 4189 (C) REFERENCE/DOCKET NUMBER: 9157-13 (ix) TELECOMMUNICATION INFORMATION:(A) TELEPHONE: (416) 364-7311 (B) TELEFAX: (416) 361-1398 (2) INFORMATION FOR SEQ ID N0:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: (2) INFORMATION FOR SEQ ID N0:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear _ 85 _ (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2: (2) INFORMATION FOR SEQ ID N0:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3: (2) INFORMATION FOR SEQ ID N0:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: (2) INFORMATION FOR SEQ ID N0:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5: (2) INFORMATION FOR SEQ ID N0:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6: (2) INFORMATION FOR SEQ ID N0:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7: (2) INFORMATION FOR SEQ ID N0:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8: (2) INFORMATION FOR SEQ ID N0:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9: (2) INFORMATION FOR SEQ ID N0:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:10: (2) INFORMATION FOR SEQ ID N0:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear _ 87 _ (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:11: (2) INFORMATION FOR SEQ ID N0:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12: (2) INFORMATION FOR SEQ ID N0:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13: (2) INFORMATION FOR SEQ ID N0:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14: (2) INFORMATION FOR SEQ ID N0:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15: _ 88 _ (2) INFORMATION FOR SEQ ID N0:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16: (2) INFORMATION FOR SEQ ID N0:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17: (2) INFORMATION FOR SEQ ID N0:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18: (2) INFORMATION FOR SEQ ID N0:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19: (2) INFORMATION FOR SEQ ID N0:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 89 _ (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20: (2) INFORMATION FOR SEQ ID N0:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21: (2) INFORMATION FOR SEQ ID N0:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22: (2) INFORMATION FOR SEQ ID N0:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23: (2) INFORMATION FOR SEQ ID N0:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24: (2) INFORMATION FOR SEQ ID N0:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

权利要求:
Claims (36)
[1] 1. A method of preparing a typing tree for typing a polymorphic gene in an organism comprising:(a) identifying polymorphic sites of the gene by comparing the sequences of all known sequences of the gene;(b) determining which polymorphic sites can be used as informative sites to type known alleles of the gene; and (c) developing a typing tree of the gene based on the DNAsequences at the informative sites of the known alleles of the gene.
[2] 2. A method of typing a polymorphic gene in an organism comprising:(a) isolating DNA comprising the gene to be typed from the organism;(b) determining the DNA sequence at the informative sites of the gene to be typed; and (c) using a typing tree prepared according to claim 1 to assign the gene to be typed to a particular allele type by comparing the DNA sequence at the informative sites of the gene to be typed with the DNA sequences at the informative sites of previously typed alleles of the gene.
[3] 3. A method of typing a polymorphic gene in an organism which is heterozygous for the gene comprising:(a) isolating DNA comprising the gene to be typed;(b) sequencing the DNA sequence at the informative sites of the gene to be typed;(c) identifying any heterozygous informative sites;(d) determining the DNA sequence at a heterozygous site by:1) only considering previously known sequence combinations at the heterozygous site; 2) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences at that site;(e) using a typing tree prepared according to claim 1 to assign sequences of the heterozygous site to a first allele and to subsequently type the first allele;(f) once the first allele has been typed, its sequence at heterozygous sites are not used in typing are checked to ensure sequences belonging to the first allele type exist at the other sites and to assist in assigning sequences at heterozygous sites to a second allele to be typed;(g) using the typing tree used in (e) to type the second allele, wherein sequences at heterozygous sites assigned to the first allele are not considered in typing the second allele; and (h) sequencing, both alleles, to ensure that all sequences belonging to the assigned allele type exists in all other locations, to confirm typing assignment and to identify any new sequence combinations warranting the assignment of a new allele type.
[4] 4. The method of claim 2 wherein the polymorphic gene is HLA-DQB1, HLA-DQA1 or HLA-DRB and the organism is a human.
[5] 5. The method of claim 4 wherein the polymorphic gene is HLA-DQB1.
[6] 6. The method of claim 5 wherein the informative sites are in exon 2 or 3.
[7] 7. A method of typing an HLA-DQB1 gene in a human comprising:(a) isolating DNA comprising the HLA-DQB1 gene to be typed; (b) determining the DNA sequence at informative codon sites of the HLA-DQB1 gene to be typed; and (c) using a typing tree as illustrated in Figure 1 to assign the HLA-DQB1 gene to be typed to a particular allele type by comparing the DNA sequence at the informative codon sites with the DNA sequences at the informative codon sites of previously typed alleles of the HLA-DQB1 gene.
[8] 8. The method of claim 7 wherein the DNA sequence at the informative codon sites of the HLA-DQB1 gene to be typed are obtained by amplifying the DNA isolated in step (a) using the polymerase chain reaction and primers selected from the least variable region of the gene and which are designed to obtain the necessary sequence information for the informative codon sites.
[9] 9. The method of claim 8 wherein the informative codon sites are in exon 2 and the primers used for amplifying the DNA are:(i) DQBDNAF 5'TCCCCGCAGAGGATTTCGTG3' (SEQ ID NO:6); and (ii) DQBDNAR 5'GGCGACGACGCTCACCTC3 (SEQ ID NO:7).
[10] 10. The method of claim 9 wherein the primers used for sequencing the DNA are selected from the group of primers consisting of:(i) DQBSEQ1 (sense) 5'GCAGAGGATTTCGTGTTCCAG3' (SEQ ID NO:8); and (ii) DQBSEQ3 (antisense) 5'CCTTCTGGCTGTTCCAGTACTC3' (SEQ ID NO:9).
[11] 11. The method of claim 7 wherein when the gene is HLA-DQB1 and an allele combination exists comprising an allele from group DQB1*04, the DQB1*04 allele is typed first.
[12] 12. The method of claim 7 wherein when the gene is HLA-DQB1 and an allele combination exists comprising an allele from group DQB1*02 and an allele from group DQB1*05, the allele in the DQB1*05 group is typed first.
[13] 13. The method of claim 8, wherein the informative codon sites of HLA-DQB1 comprise codons: 9, 14, 23, 30, 35, 37, 38, 45, 47, 48, 49, 51, 56, 57, 62, 70, 74, 135, and 137.
[14] 14. The method of claim 4 wherein the polymorphic gene is HLA-DQA1.
[15] 15. The method of claim 14 wherein the informative sites are in exons 1, 2, 3 or 4.
[16] 16. A method of typing an HLA- DQA1 gene in a human comprising:(a) isolating DNA comprising the HLA-DQA1 gene to be typed;(b) determining the DNA sequence at informative codon sites of the HLA-DQA1 gene to be typed; and (c) using a typing tree as illustrated in Figure 2 to assign the HLA-DQA1 gene to be typed to a particular allele type by comparing the DNA sequence at the informative codon sites with the DNA sequences at the informative codon sites of previously typed alleles of the HLA-DQA1 gene.
[17] 17. The method of claim 16 wherein the DNA sequence at the informative codon sites of the HLA-DQA1 gene to be typed are obtained by amplifying the DNA isolated in step (a) using the polymerase chain reaction and primers selected from the least variable region of the gene and which are designed to obtain the necessary sequence information for the informative codon sites.
[18] 18. The method of claim 17 wherein the primers used for amplifying the DNA are:(i) DQADNAF2 5'ATCTTCACTCATCAGCTGACCA3' (SEQ ID NO:1);and (ii) DQADNAR2 5'GCTGACCCAGTGTCACGGGAG3' (SEQ ID NO:2).
[19] 19. The method of claim 18 wherein the primers used for sequencing the DNA are selected from the group of primers consisting of (i) DQASEQ3 (sense) 5'GCCTCTTGTGGTGTAAACTTG3' (SEQ ID NO:3);(ii) DQASEQ2 (antisense) 5'CATTGGTAGCAGCAGTAG3' (SEQ ID NO:4); and (iii) DQASEQ4 (antisense) 5'CTTCCTCTCCAGGTCCACATA3' (SEQ ID NO:5).
[20] 20. The method of claim 19 wherein sequencing primers DQASEQ3 and DQASEQ4 are used to type alleles from group DQA1*05.
[21] 21. The method of claim 19 wherein sequencing primers DQASEQ2 and DQASEQ3 are used to type all alleles except alleles from group DQA1*05.
[22] 22. The method of claim 17, wherein the informative codon sites of HLA-DQA1 comprise codons: 2, 8, 21, 25, 26, 34, 41, 45, 47, 52, 59,, 67, 68, 109, 160, 172, 199.
[23] 23. A method of typing a polymorphic gene in an organism comprising:(a) isolating DNA comprising the polymorphic gene to be typed from the organism;(b) amplifying the isolated DNA in a polymerase chain reaction using primers that selectively amplify the polymorphic gene to obtain PCR reaction products;(c) sequencing the PCR reaction products of step (b);(d) assigning an allele group to the gene based on the sequence data obtained in step (c);(e) amplifying the PCR reaction products of step (b) using primers that selectively amplify the allele group determined in step (d);(f) sequencing the PCR reaction products of step (e); and (g) assigning an allele to the gene using a typing tree prepared according to the method of claim 1 by comparing the DNAsequence at the informative sites of the gene to be typed with the DNAsequences at the informative sites of previously typed alleles of the gene.
[24] 24. A method according to claim 23 wherein the gene is HLA-DRB.
[25] 25. A method according to claim 24 wherein the primers used in step (b) amplify exon 2 DNA of all DRB genes.
[26] 26. A method according to claim 25 wherein the primer is DRBSEQ4 having the sequence shown in Table 10.
[27] 27. A method according to claim 24 wherein the typing tree is as illustrated in any one of Figures 3 to 20.
[28] 28. A method according to claim 24 wherein the allele group is assigned in step (d) using the critical codons in Table 11.
[29] 29. A computer based method for typing an input gene sequence, comprising the steps of:a) providing a gene sequence database, said database containing a plurality of gene sequence records;b) removing any invalid codons from said input gene sequence;c) comparing condons in said input gene sequence to a set of working codons in each of said gene sequence records;d) if said input gene sequence matches one of said gene sequence records, recording a match; and e) outputting all matched sequence records.
[30] 30. A computer readable medium having stored thereon computer-readable instructs for performing the steps comprising:a) providing a gene sequence database, said database containing a plurality of gene sequence records;b) removing any invalid codons from said input gene sequence;c) comparing condons in said input gene sequence to a set of working codons in each of said gene sequence records;d) if said input gene sequence matches one of said gene sequence records, recording a match; and e) outputting all matched sequence records.
[31] 31. A computer system for typing a gene sequence, said system comprising:a) a sequence database, said database containing a plurality of gene sequence records;b) input means for receiving input data, said input data to be compared with said gene sequence records; c) processing means for comparing said input data with said gene sequence records; and d) output means for outputting said gene sequence records that match said input data.
[32] 32. A computer based method to prepare a typing tree comprising the steps of:(A) inputting all known DNA sequences of known alleles of the gene into a database;(B) searching the database for all polymorphic sites of the gene and identifying informative sites which can be used to type the known alleles of the gene; and (C) developing a typing tree based on the known DNA sequences at the informative sites of the known alleles of the gene.
[33] 33. A computer based method to type a gene comprising:(1) inputting the DNA sequence at informative sites of the gene to be typed, recording more than one DNA sequence at a particular location if required;(2) searching the inputted DNA sequence in (1) for heterozygous sites;(3) if no heterozygous sites are located in step (2) then the allele of the gene is typed using the typing tree developed above;(4) if heterozygous sites are located:(i) determining the sequence at a heterozygous codon site by;a) only considering previously known sequence combinations at the heterozygous site; and b) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences at that site; (ii) having the computer program use the typing tree prepared above to assign the sequence of the heterozygous site to a first allele and to subsequently type the first allele;(iii) once the first allele has been typed checking, its sequence at heterozygous sites not used in typing to ensure sequences belonging to the first allele type exist at the other heterozygous sites and to assign sequences to the first allele at these sites; and (iv) assigning sequences at heterologous sites to a second allele to be typed wherein sequences at heterozygous positions assigned to the first allele are not considered in typing the second allele and using the typing tree prepared above to type the second allele; and (5) optionally inputting the full or partial sequences of both alleles, or one allele in the case of an the organism that is homozygous for the gene, and checking to ensure that all sequences belonging to the assigned allele type exist at other sequence sites, to confirm typing assignment and to identify any new sequence combinations warranting the assignment of a new allele type.
[34] 34. A computer readable medium having stored thereon computer-executable instructions for performing the steps comprising:(A) inputting all known DNA sequences of known alleles of the gene into a database;(B) searching the database for all polymorphic codon sites of the gene and identifying informative codon sites which can be used to type the known alleles of the gene;(C) developing a typing tree based on the known DNA sequences at the informative codon sites of the known alleles of the gene;(D) inputting the DNA sequence at informative codon sites of the gene to be typed, recording more than one DNA sequence at a particular location if required; (E) searching the inputted DNA sequence in (D) for heterozygous codon sites;(F) if no heterozygous codon sites are located in step (E) then the allele of the gene is typed using the typing tree developed in step (C);(G) if heterozygous sites are located:(i) determining the sequence of the codons at a heterozygous codon site by;1) only considering previously known codon sequence combinations at the heterozygous site; and 2) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences of the codons at that site;(ii) having the computer program use the typing tree prepared in (C) to assign codons of the heterozygous site to a first allele and to subsequently type the first allele;(iii) once the first allele has been typed checking, its sequence at heterozygous sites not used in typing to ensure codons belonging to the first allele type exist at the other heterozygous sites and to assign codons to the first allele at these sites; and (iv) assigning codons at heterologous sites to a second allele to be typed wherein codons at heterozygous positions assigned to the first allele are not considered in typing the second allele and using the typing tree prepared in (C) to type the second allele; and (H) optionally inputting the DNA sequence of the alleles of the genes that were typed, and checking to ensure that codons belonging to the assigned allele type exist at other codon sites, to confirm typing assignment and to identify any new codon combinations warranting the assignment of a new allele type.
[35] 35. A computer based method of typing polymorphic genes in an organism comprising the steps of:(A) inputting all known DNA sequences of known alleles of the gene into a database;(B) searching the database for all polymorphic codon sites of the gene and identifying informative codon sites which can be used to type the known alleles of the gene;(C) developing a typing tree based on the known DNA sequences at the informative codon sites of the known alleles of the gene;(D) inputting the DNA sequence at informative codon sites of the gene to be typed, recording more than one DNA sequence at a particular location if required;(E) searching the inputted DNA sequence in (D) for heterozygous codon sites;(F) if no heterozygous codon sites are located in step (E) then the allele of the gene is typed using the typing tree developed in step (C);(G) if heterozygous sites are located:(i) determining the sequence of the codons at a heterozygous codon site by;1) only considering previously known codon sequence combinations at the heterozygous site; and 2) using all nucleotide information obtained from sequencing the heterozygous site to determine the possible sequences of the codons at that site;(ii) having the computer program use the typing tree prepared in (C) to assign codons of the heterozygous site to a first allele and to subsequently type the first allele;(iii) once the first allele has been typed checking, its sequence at heterozygous sites not used in typing to ensure codons belonging to the first allele type exist at the other heterozygous sites and to assign codons to the first allele at these sites; and (iv) assigning codons at heterologous sites to a second allele to be typed wherein codons at heterozygous positions assigned to the first allele are not considered in typing the second allele and using the typing tree prepared in (C) to type the second allele; and (H) optionally inputting the DNA sequence of the alleles of the genes that were typed, and checking to ensure that codons belonging to the assigned allele type exist at other codon sites, to confirm typing assignment and to identify any new codon combinations warranting the assignment of a new allele type.
[36] 36. A computer based method of typing polymorphic genes in an organism comprising the steps of:(A) inputting all known DNA sequences of known alleles of the gene into a database;(B) searching the database for all polymorphic codon sites of the gene and identifying informative codon sites which can be used to type the known alleles of the gene;(C) developing a typing tree based on the known DNA sequences at the informative codon sites of the known alleles of the gene;(D) inputting the DNA sequence at informative codon sites of the gene to be typed, recording more than one DNA sequence at a particular location if required;(E) using the typing tree developed in step (C) to type the allele of the gene; and (F) optionally inputting the DNA sequence of the allele of the gene that was typed, and checking to ensure that codons belonging to the assigned allele type exist at other codon sites, to confirm typing assignment and to identify any new codon combinations warranting the assignment of a new allele type.

类似技术:

---

公开号 | 公开日 | 专利标题

---

Fan et al.2017|HLA association with drug-induced adverse reactions

---

Wordsworth et al.1991|Polygenic susceptibility in rheumatoid arthritis.

---

Winchester1994|The molecular basis of susceptibility to rheumatoid arthritis

---

Walter et al.2003|IDDM2/insulin VNTR modifies risk conferred by IDDM1/HLA for development of type 1 diabetes and associated autoimmunity

---

Allen et al.1994|Association of susceptibility to multiple sclerosis in Sweden with HLA class II DRB1 and DQB1 alleles

---

Weyand et al.1992|Homozygosity for the HLA-DRB1 allele selects for extraarticular manifestations in rheumatoid arthritis.

---

Shindo et al.1994|HLA-DRB1 typing of Vogt-Koyanagi-Harada's disease by PCR-RFLP and the strong association with DRB1* 0405 and DRB1* 0410.

---

Bernal et al.1999|Association of tumor necrosis factor polymorphism with primary sclerosing cholangitis

---

Gabriel et al.2009|Rapid high-throughput human leukocyte antigen typing by massively parallel pyrosequencing for high-resolution allele identification

---

Grimsley et al.2002|Definitive high resolution typing of HLA‐E allelic polymorphisms: identifying potential errors in existing allele data

---

Adams et al.2004|Ambiguous allele combinations in HLA Class I and Class II sequence-based typing: when precise nucleotide sequencing leads to imprecise allele identification

---

Holm et al.2005|Distinct HLA-C/KIR genotype profile associates with guttate psoriasis

---

Miyasaka et al.2011|The diversity of bovine MHC class II DRB3 and DQA1 alleles in different herds of Japanese Black and Holstein cattle in Japan

---

Wordsworth et al.1992|The immunogenetics of rheumatoid arthritis

---

Gao et al.2006|Diversity of MICA and linkage disequilibrium with HLA-B in two North American populations

---

Luo et al.1999|High‐resolution sequence typing of HLA‐DQA1 and‐DQB1 exon 2 DNA with taxonomy‐based sequence analysis | allele assignment

---

Fekih-Mrissa et al.2013|Association of HLA-DR/DQ polymorphism with myasthenia gravis in Tunisian patients

---

Kastelan et al.2000|Analysis of HLA antigens in Croatian patients with psoriasis.

---

Fei et al.1991|Specific hla‐dqa and hla‐drb1 alleles confer susceptibility to sjögren's syndrome and autoantibody production

---

Li et al.1991|The DQw7 allele at the HLA-DQB locus is associated with susceptibility to IgA nephropathy in Caucasians

---

Knipper et al.2000|HLA-DRB1, 3, 4, 5 and-DQB1 allele frequencies and HLA-DR/DQ linkage disequilibrium of 231 German caucasoid patients and their corresponding 821 potential unrelated stem cell transplants

---

Shimizu et al.2019|HLA-C variants associated with amino acid substitutions in the peptide binding groove influence susceptibility to Kawasaki disease

---

JP2003500067A|2003-01-07|Method for analyzing a patient's genetic predisposition to at least one disease and amplification adapted to the method

---

Luo et al.2001|Two-step high resolution sequence-based HLA-DRB typing of exon 2 DNA with taxonomy-based sequence analysis allele assignment

---

Arrieta-Bolaños et al.2014|The frequency of HLA-B∗ 57: 01 and the risk of abacavir hypersensitivity reactions in the majority population of Costa Rica

同族专利:

---

公开号 | 公开日

---

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
2006-03-10| FZDE| Dead|

优先权:

---

申请号 | 申请日 | 专利标题

---

US12411399P| true| 1999-03-12|1999-03-12||

---

US60/124,113||1999-03-12||

---